Incidental Mutation 'R6797:Ocln'
ID533068
Institutional Source Beutler Lab
Gene Symbol Ocln
Ensembl Gene ENSMUSG00000021638
Gene Nameoccludin
SynonymsOcl
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.686) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location100496507-100552718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100539715 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 90 (D90G)
Ref Sequence ENSEMBL: ENSMUSP00000124849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022140] [ENSMUST00000069756] [ENSMUST00000159459] [ENSMUST00000159515] [ENSMUST00000160859]
Predicted Effect probably damaging
Transcript: ENSMUST00000022140
AA Change: D90G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022140
Gene: ENSMUSG00000021638
AA Change: D90G

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 6.6e-29 PFAM
Pfam:Occludin_ELL 419 518 8.8e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000069756
AA Change: D90G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065284
Gene: ENSMUSG00000021638
AA Change: D90G

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 3.3e-29 PFAM
Pfam:Occludin_ELL 419 518 3.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159459
SMART Domains Protein: ENSMUSP00000125642
Gene: ENSMUSG00000021638

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Occludin_ELL 170 269 6.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159515
SMART Domains Protein: ENSMUSP00000125595
Gene: ENSMUSG00000021638

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160859
AA Change: D90G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124849
Gene: ENSMUSG00000021638
AA Change: D90G

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 6.6e-29 PFAM
Pfam:Occludin_ELL 419 518 8.8e-35 PFAM
Meta Mutation Damage Score 0.6408 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous null mice display gastritis, loss of gastric parietal and chief cells, gastric mucus cell hyperplasia, reduced gastric acid secretion, growth retardation, male infertility, seminiferous tubule atrophy, failure to nurse pups, mineral deposits in the brain, and thinning of the compact bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Ocln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ocln APN 13 100535013 missense probably damaging 1.00
IGL02231:Ocln APN 13 100541114 missense probably damaging 1.00
LCD18:Ocln UTSW 13 100520567 intron probably benign
R0635:Ocln UTSW 13 100506236 missense probably damaging 1.00
R1809:Ocln UTSW 13 100511459 nonsense probably null
R2047:Ocln UTSW 13 100535124 missense probably damaging 1.00
R2193:Ocln UTSW 13 100539904 missense probably damaging 0.99
R2259:Ocln UTSW 13 100535029 missense probably damaging 1.00
R3793:Ocln UTSW 13 100498894 missense possibly damaging 0.50
R4534:Ocln UTSW 13 100511604 missense possibly damaging 0.63
R4947:Ocln UTSW 13 100539715 missense probably damaging 1.00
R5055:Ocln UTSW 13 100539422 missense probably benign 0.11
R5061:Ocln UTSW 13 100539598 missense probably damaging 1.00
R5218:Ocln UTSW 13 100506314 missense probably damaging 1.00
R5302:Ocln UTSW 13 100506299 missense probably damaging 0.99
R5916:Ocln UTSW 13 100506179 missense possibly damaging 0.64
R6257:Ocln UTSW 13 100539509 missense probably benign 0.00
R6960:Ocln UTSW 13 100498872 missense possibly damaging 0.89
R6967:Ocln UTSW 13 100539288 nonsense probably null
R7000:Ocln UTSW 13 100534962 critical splice donor site probably null
R7176:Ocln UTSW 13 100515082 missense probably damaging 0.97
R7176:Ocln UTSW 13 100515083 missense probably benign 0.16
R7709:Ocln UTSW 13 100539598 missense probably damaging 1.00
X0023:Ocln UTSW 13 100511582 missense probably benign 0.00
Z1088:Ocln UTSW 13 100535052 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACATTCCAGATCTTATAACACTGGTC -3'
(R):5'- ATGGCGGAGAGATGCATGTC -3'

Sequencing Primer
(F):5'- TGGTCACAAATATTACTAAGGAAGCG -3'
(R):5'- AGAGATGCATGTCCGGCC -3'
Posted On2018-08-29