Incidental Mutation 'R6797:Krt5'
ID533073
Institutional Source Beutler Lab
Gene Symbol Krt5
Ensembl Gene ENSMUSG00000061527
Gene Namekeratin 5
SynonymsKrt2-5, Tfip8, 3300001P10Rik, K5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location101707070-101712898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101712641 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 57 (Y57C)
Ref Sequence ENSEMBL: ENSMUSP00000023709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023709]
Predicted Effect unknown
Transcript: ENSMUST00000023709
AA Change: Y57C
SMART Domains Protein: ENSMUSP00000023709
Gene: ENSMUSG00000061527
AA Change: Y57C

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 158 3.6e-44 PFAM
Filament 161 474 1.58e-174 SMART
low complexity region 483 577 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198689
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the basal layer of the epidermis with family member KRT14. Mutations in these genes have been associated with a complex of diseases termed epidermolysis bullosa simplex. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within the first hour after birth. They have a loose, fragile epidermal layer and abnormal epithelium in parts of the digestive tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Krt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Krt5 APN 15 101712641 missense unknown
IGL01949:Krt5 APN 15 101710613 missense probably benign 0.14
IGL03013:Krt5 APN 15 101711668 missense probably benign 0.00
IGL03286:Krt5 APN 15 101707548 missense unknown
R1598:Krt5 UTSW 15 101712441 missense probably benign 0.38
R1697:Krt5 UTSW 15 101710585 missense probably benign 0.06
R1967:Krt5 UTSW 15 101711659 missense probably benign 0.21
R2143:Krt5 UTSW 15 101712359 missense probably damaging 1.00
R2438:Krt5 UTSW 15 101711658 missense probably benign 0.10
R4633:Krt5 UTSW 15 101711607 missense probably damaging 0.98
R4771:Krt5 UTSW 15 101709059 missense probably damaging 0.99
R4918:Krt5 UTSW 15 101710307 missense probably damaging 1.00
R5622:Krt5 UTSW 15 101709035 missense probably damaging 1.00
R6873:Krt5 UTSW 15 101712877 start gained probably benign
R7808:Krt5 UTSW 15 101709018 missense probably benign 0.01
R8010:Krt5 UTSW 15 101712356 missense probably damaging 1.00
R8252:Krt5 UTSW 15 101712359 missense probably damaging 1.00
X0019:Krt5 UTSW 15 101712368 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAACGGTGACCTCTTGGATGC -3'
(R):5'- AACCATCATGTCTCGCCAGTC -3'

Sequencing Primer
(F):5'- TGGATGCCTCCAGGTGG -3'
(R):5'- AGTCCAGTGTGTCCTTCCGAAG -3'
Posted On2018-08-29