Incidental Mutation 'R6797:Ppp6r3'
ID533077
Institutional Source Beutler Lab
Gene Symbol Ppp6r3
Ensembl Gene ENSMUSG00000024908
Gene Nameprotein phosphatase 6, regulatory subunit 3
SynonymsPp6r3, D19Ertd703e, D19Bwg1430e, 4930528G08Rik, Saps3, 9130026N02Rik, Pptcs3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.876) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location3454928-3575749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3514719 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 185 (W185R)
Ref Sequence ENSEMBL: ENSMUSP00000109630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025846] [ENSMUST00000113997] [ENSMUST00000172362]
Predicted Effect probably damaging
Transcript: ENSMUST00000025846
AA Change: W185R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025846
Gene: ENSMUSG00000024908
AA Change: W185R

DomainStartEndE-ValueType
coiled coil region 25 52 N/A INTRINSIC
Pfam:SAPS 128 365 2.7e-69 PFAM
Pfam:SAPS 360 513 1.4e-44 PFAM
low complexity region 609 627 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113997
AA Change: W185R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109630
Gene: ENSMUSG00000024908
AA Change: W185R

DomainStartEndE-ValueType
coiled coil region 25 52 N/A INTRINSIC
Pfam:SAPS 128 365 5.8e-69 PFAM
Pfam:SAPS 363 513 2.7e-44 PFAM
low complexity region 638 656 N/A INTRINSIC
low complexity region 772 787 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172362
AA Change: W185R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131084
Gene: ENSMUSG00000024908
AA Change: W185R

DomainStartEndE-ValueType
coiled coil region 25 52 N/A INTRINSIC
Pfam:SAPS 128 365 2.6e-69 PFAM
Pfam:SAPS 360 513 1.3e-44 PFAM
low complexity region 592 610 N/A INTRINSIC
low complexity region 726 741 N/A INTRINSIC
Meta Mutation Damage Score 0.9567 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase regulatory subunits, such as SAPS3, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS3 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Ppp6r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ppp6r3 APN 19 3514729 splice site probably null
IGL00340:Ppp6r3 APN 19 3518324 missense probably damaging 1.00
IGL00585:Ppp6r3 APN 19 3490826 missense probably damaging 0.99
IGL01304:Ppp6r3 APN 19 3467261 missense probably damaging 0.99
IGL02048:Ppp6r3 APN 19 3473848 missense possibly damaging 0.96
IGL02055:Ppp6r3 APN 19 3521781 missense probably benign 0.01
IGL02108:Ppp6r3 APN 19 3492494 missense probably damaging 1.00
IGL02227:Ppp6r3 APN 19 3518245 missense possibly damaging 0.56
IGL02427:Ppp6r3 APN 19 3466580 missense probably null
IGL02441:Ppp6r3 APN 19 3464693 missense probably benign 0.14
IGL02805:Ppp6r3 APN 19 3492428 missense probably benign 0.15
IGL03298:Ppp6r3 APN 19 3521829 missense probably damaging 0.97
PIT1430001:Ppp6r3 UTSW 19 3471059 nonsense probably null
R0324:Ppp6r3 UTSW 19 3464693 missense probably benign 0.00
R0362:Ppp6r3 UTSW 19 3478285 missense probably damaging 0.96
R1876:Ppp6r3 UTSW 19 3471971 splice site probably benign
R2860:Ppp6r3 UTSW 19 3521782 missense possibly damaging 0.49
R2861:Ppp6r3 UTSW 19 3521782 missense possibly damaging 0.49
R2862:Ppp6r3 UTSW 19 3521782 missense possibly damaging 0.49
R3958:Ppp6r3 UTSW 19 3496583 missense probably damaging 0.99
R4158:Ppp6r3 UTSW 19 3512037 missense probably damaging 0.97
R4160:Ppp6r3 UTSW 19 3512037 missense probably damaging 0.97
R4473:Ppp6r3 UTSW 19 3511978 missense probably damaging 1.00
R4901:Ppp6r3 UTSW 19 3467229 missense probably damaging 1.00
R4996:Ppp6r3 UTSW 19 3473833 missense probably damaging 0.98
R5139:Ppp6r3 UTSW 19 3464610 missense probably damaging 1.00
R5414:Ppp6r3 UTSW 19 3507330 missense probably damaging 1.00
R5776:Ppp6r3 UTSW 19 3526901 missense possibly damaging 0.77
R6290:Ppp6r3 UTSW 19 3494011 missense probably benign
R6525:Ppp6r3 UTSW 19 3493936 missense probably damaging 0.99
R6977:Ppp6r3 UTSW 19 3467272 missense probably damaging 1.00
R7176:Ppp6r3 UTSW 19 3471989 missense probably damaging 0.99
R7178:Ppp6r3 UTSW 19 3518337 missense probably benign 0.00
R7239:Ppp6r3 UTSW 19 3493981 missense probably benign 0.38
R7326:Ppp6r3 UTSW 19 3507325 missense probably damaging 1.00
R7536:Ppp6r3 UTSW 19 3507341 missense possibly damaging 0.80
R7583:Ppp6r3 UTSW 19 3490790 missense probably benign
R7991:Ppp6r3 UTSW 19 3459750 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTAGCATGACCCACCTCTGG -3'
(R):5'- TCACTGCATTTTCCTTGGGG -3'

Sequencing Primer
(F):5'- CCACCTCTGGGAAGGAGATG -3'
(R):5'- TCCTTGGGGGACTTTTTAATTTTC -3'
Posted On2018-08-29