Incidental Mutation 'R6797:Fen1'
ID533078
Institutional Source Beutler Lab
Gene Symbol Fen1
Ensembl Gene ENSMUSG00000024742
Gene Nameflap structure specific endonuclease 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10199132-10204169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10200703 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 126 (F126L)
Ref Sequence ENSEMBL: ENSMUSP00000117246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010807] [ENSMUST00000025651] [ENSMUST00000040372] [ENSMUST00000116542] [ENSMUST00000142241] [ENSMUST00000156291]
Predicted Effect probably benign
Transcript: ENSMUST00000010807
SMART Domains Protein: ENSMUSP00000010807
Gene: ENSMUSG00000010663

DomainStartEndE-ValueType
Cyt-b5 22 97 1.32e-19 SMART
transmembrane domain 134 156 N/A INTRINSIC
Pfam:FA_desaturase 158 421 7.4e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025651
AA Change: F126L

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025651
Gene: ENSMUSG00000024742
AA Change: F126L

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040372
SMART Domains Protein: ENSMUSP00000044751
Gene: ENSMUSG00000036372

DomainStartEndE-ValueType
Pfam:UPF0197 3 79 3.3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116542
AA Change: F126L

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112241
Gene: ENSMUSG00000024742
AA Change: F126L

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142241
AA Change: F126L

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119221
Gene: ENSMUSG00000024742
AA Change: F126L

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156291
AA Change: F126L

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117246
Gene: ENSMUSG00000024742
AA Change: F126L

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Meta Mutation Damage Score 0.1183 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene removes 5' overhanging flaps in DNA repair and processes the 5' ends of Okazaki fragments in lagging strand DNA synthesis. Direct physical interaction between this protein and AP endonuclease 1 during long-patch base excision repair provides coordinated loading of the proteins onto the substrate, thus passing the substrate from one enzyme to another. The protein is a member of the XPG/RAD2 endonuclease family and is one of ten proteins essential for cell-free DNA replication. DNA secondary structure can inhibit flap processing at certain trinucleotide repeats in a length-dependent manner by concealing the 5' end of the flap that is necessary for both binding and cleavage by the protein encoded by this gene. Therefore, secondary structure can deter the protective function of this protein, leading to site-specific trinucleotide expansions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not form an inner cell mass, lack DNA synthesis in blastocyst giant cells and die by embryonic day 9.5. Embryonic day 3.5 blastocysts are hypersensitive to irradiation. Heterozygotes show enhanced adenocarcinoma susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Lipn A T 19: 34,080,760 M294L probably benign Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Fen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02991:Fen1 UTSW 19 10200662 missense probably benign
R3161:Fen1 UTSW 19 10200291 missense probably damaging 0.96
R4245:Fen1 UTSW 19 10200367 missense probably damaging 0.99
R5481:Fen1 UTSW 19 10200658 missense probably damaging 1.00
R5553:Fen1 UTSW 19 10200423 missense probably benign
R5733:Fen1 UTSW 19 10200658 missense possibly damaging 0.86
R5783:Fen1 UTSW 19 10200830 nonsense probably null
R6244:Fen1 UTSW 19 10200687 missense probably damaging 1.00
R6498:Fen1 UTSW 19 10200115 missense probably damaging 0.96
R7988:Fen1 UTSW 19 10200310 missense possibly damaging 0.94
R8374:Fen1 UTSW 19 10200460 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CTCACTGGCAGTTAAGTGTCG -3'
(R):5'- GGGCATGTTCTACCGTACCATC -3'

Sequencing Primer
(F):5'- CAGTTAAGTGTCGCATTAGCACG -3'
(R):5'- CATCCGCATGATGGAGAATGGC -3'
Posted On2018-08-29