Incidental Mutation 'R6798:Prkd2'
ID533107
Institutional Source Beutler Lab
Gene Symbol Prkd2
Ensembl Gene ENSMUSG00000041187
Gene Nameprotein kinase D2
SynonymsPKD2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6798 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location16842902-16870464 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 16849203 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 297 (K297*)
Ref Sequence ENSEMBL: ENSMUSP00000131192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086104] [ENSMUST00000168093]
Predicted Effect probably null
Transcript: ENSMUST00000086104
AA Change: K297*
SMART Domains Protein: ENSMUSP00000083273
Gene: ENSMUSG00000041187
AA Change: K297*

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
C1 139 188 2.87e-11 SMART
C1 266 315 1.28e-17 SMART
low complexity region 353 373 N/A INTRINSIC
PH 399 512 2.07e-6 SMART
S_TKc 552 808 6.12e-92 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168093
AA Change: K297*
SMART Domains Protein: ENSMUSP00000131192
Gene: ENSMUSG00000041187
AA Change: K297*

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
C1 139 188 2.87e-11 SMART
C1 266 315 1.28e-17 SMART
low complexity region 353 373 N/A INTRINSIC
PH 399 512 2.07e-6 SMART
S_TKc 552 808 6.12e-92 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase D (PKD) family of serine/threonine protein kinases. This kinase can be activated by phorbol esters as well as by gastrin via the cholecystokinin B receptor (CCKBR) in gastric cancer cells. It can bind to diacylglycerol (DAG) in the trans-Golgi network (TGN) and may regulate basolateral membrane protein exit from TGN. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired IgM and IgG1 antigen responses and CD4+ and CD8+ T cell production of IL2 and IFN-gamma in response to TCR stimulation. Mice homozygous for a gene trap allele exhibit normal T lymphocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310046K23Rik G C 3: 92,532,936 C65W unknown Het
Abcb1a T C 5: 8,732,364 Y916H probably damaging Het
Adam11 A G 11: 102,777,008 I740V probably damaging Het
Adam22 A T 5: 8,160,784 D161E probably damaging Het
Agap3 A G 5: 24,498,282 probably null Het
Ank2 T C 3: 126,944,264 probably benign Het
Aspm T A 1: 139,468,685 H867Q possibly damaging Het
Aurkaip1 T C 4: 155,832,739 probably null Het
BC048507 A C 13: 67,863,564 D20A probably benign Het
Cacna1a G A 8: 84,611,602 A1704T probably damaging Het
Cep152 A C 2: 125,566,527 probably null Het
Cep19 T C 16: 32,104,049 probably null Het
Chd9 A T 8: 91,051,554 E2731V possibly damaging Het
Chrd T C 16: 20,734,306 L139P probably damaging Het
Cit A G 5: 115,926,526 E489G possibly damaging Het
Clcn7 A G 17: 25,159,760 N720D probably damaging Het
Col6a3 T C 1: 90,795,009 probably null Het
Dchs2 T A 3: 83,348,286 Y2430N probably damaging Het
Dpy30 A G 17: 74,307,756 I64T probably damaging Het
Eif2b3 G T 4: 117,066,458 W290L probably benign Het
Epha6 T G 16: 60,605,064 E62A possibly damaging Het
Epha6 C T 16: 60,605,065 E62K possibly damaging Het
Epha8 C T 4: 136,945,669 R268Q probably benign Het
Fam155a G A 8: 9,770,205 Q272* probably null Het
Fbxw17 C A 13: 50,433,264 probably null Het
Fndc8 C T 11: 82,892,391 T66I probably benign Het
Frmpd1 A G 4: 45,284,850 T1224A probably benign Het
Gcm2 T C 13: 41,105,885 D36G probably damaging Het
Glt28d2 T C 3: 85,871,989 D59G probably benign Het
Gm4788 T C 1: 139,698,121 T813A probably benign Het
Gorasp1 T C 9: 119,929,597 D243G probably benign Het
Gtsf1l T C 2: 163,087,471 K31E probably benign Het
Heatr5a A G 12: 51,881,265 V1816A probably benign Het
Il10ra T C 9: 45,256,432 K274E probably damaging Het
Il1rl2 T C 1: 40,365,240 I507T probably damaging Het
Jak3 T G 8: 71,680,971 F408V probably damaging Het
Kdm1b A G 13: 47,068,536 T484A probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Map9 T G 3: 82,380,164 L31W probably damaging Het
Micalcl T C 7: 112,376,059 probably benign Het
Mt1 A G 8: 94,179,888 probably benign Het
Myo18b T C 5: 112,761,386 I1964V probably damaging Het
Nod1 A T 6: 54,944,611 C241S probably damaging Het
Nrxn1 T A 17: 90,629,950 D685V probably damaging Het
Olfr504 T A 7: 108,565,760 K12* probably null Het
Olfr695 T C 7: 106,714,195 Y162C probably damaging Het
Olfr730 A G 14: 50,187,127 V30A probably benign Het
Olfr96 T G 17: 37,225,806 L227R probably damaging Het
Oog1 A T 12: 87,608,839 probably null Het
P4htm T A 9: 108,582,918 N219I possibly damaging Het
Pcif1 T C 2: 164,885,791 L168P possibly damaging Het
Pde4dip A G 3: 97,888,534 V46A probably benign Het
Pias1 T C 9: 62,892,169 T480A probably benign Het
Prl7d1 T A 13: 27,709,397 probably null Het
Pxdc1 G T 13: 34,652,425 A4E possibly damaging Het
Rcor1 A G 12: 111,039,886 probably benign Het
Rev3l A T 10: 39,854,763 D2761V probably damaging Het
Scgb1b7 A G 7: 31,712,981 T61A probably damaging Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Setd4 C A 16: 93,589,953 V286F probably damaging Het
Slc22a29 A G 19: 8,160,604 S536P probably benign Het
Snx25 T C 8: 46,033,773 H977R probably damaging Het
Spint5 T A 2: 164,717,140 C95* probably null Het
Srgap1 T C 10: 121,925,904 D113G probably damaging Het
Stxbp2 T A 8: 3,641,180 S476T probably benign Het
Tg A G 15: 66,678,839 T273A probably damaging Het
Tnc C T 4: 63,965,604 R1868H probably benign Het
Trappc10 A G 10: 78,188,831 Y1155H probably benign Het
Trpm2 T A 10: 77,914,740 N1341Y probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfand1 T G 3: 10,346,176 K67T probably benign Het
Zfand4 A C 6: 116,328,253 K214Q probably benign Het
Zfp653 A T 9: 22,057,372 V465E probably damaging Het
Zswim8 A G 14: 20,715,992 Y782C probably damaging Het
Other mutations in Prkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Prkd2 APN 7 16865862 missense probably damaging 1.00
IGL01138:Prkd2 APN 7 16848811 missense probably damaging 1.00
IGL01714:Prkd2 APN 7 16863942 missense probably damaging 1.00
IGL01968:Prkd2 APN 7 16869576 splice site probably null
IGL01969:Prkd2 APN 7 16865757 missense probably damaging 1.00
IGL02354:Prkd2 APN 7 16847658 missense probably damaging 1.00
IGL02361:Prkd2 APN 7 16847658 missense probably damaging 1.00
IGL02504:Prkd2 APN 7 16857832 missense probably damaging 1.00
IGL02804:Prkd2 APN 7 16855890 missense probably benign 0.04
IGL02834:Prkd2 APN 7 16845934 missense probably damaging 0.97
IGL02962:Prkd2 APN 7 16869832 missense probably benign 0.01
IGL03053:Prkd2 APN 7 16850263 missense possibly damaging 0.63
IGL03168:Prkd2 APN 7 16850263 missense possibly damaging 0.63
alila UTSW 7 16847654 missense probably damaging 1.00
Beaches UTSW 7 16849203 nonsense probably null
Purnama UTSW 7 16869565 missense probably damaging 1.00
Sandals UTSW 7 16865714 missense probably damaging 1.00
R0024:Prkd2 UTSW 7 16847643 missense probably damaging 1.00
R0173:Prkd2 UTSW 7 16849044 missense probably benign
R0190:Prkd2 UTSW 7 16869890 missense probably damaging 1.00
R0834:Prkd2 UTSW 7 16865677 splice site probably benign
R1418:Prkd2 UTSW 7 16869545 missense probably benign 0.03
R1488:Prkd2 UTSW 7 16858439 missense probably damaging 1.00
R1648:Prkd2 UTSW 7 16857807 missense possibly damaging 0.51
R2015:Prkd2 UTSW 7 16847677 nonsense probably null
R2042:Prkd2 UTSW 7 16856268 missense possibly damaging 0.86
R2101:Prkd2 UTSW 7 16869565 missense probably damaging 1.00
R3884:Prkd2 UTSW 7 16853255 missense probably benign 0.02
R4601:Prkd2 UTSW 7 16843648 unclassified probably benign
R4979:Prkd2 UTSW 7 16848727 missense probably damaging 1.00
R5240:Prkd2 UTSW 7 16855786 missense probably benign 0.09
R5643:Prkd2 UTSW 7 16843792 missense probably benign 0.02
R5994:Prkd2 UTSW 7 16850336 missense probably benign 0.00
R6033:Prkd2 UTSW 7 16865714 missense probably damaging 1.00
R6033:Prkd2 UTSW 7 16865714 missense probably damaging 1.00
R6361:Prkd2 UTSW 7 16847654 missense probably damaging 1.00
R6738:Prkd2 UTSW 7 16865905 missense possibly damaging 0.64
R6815:Prkd2 UTSW 7 16843793 missense probably benign 0.00
R7241:Prkd2 UTSW 7 16857805 missense probably benign 0.44
R7293:Prkd2 UTSW 7 16845940 missense possibly damaging 0.88
R7323:Prkd2 UTSW 7 16847622 missense probably benign 0.07
R7900:Prkd2 UTSW 7 16853344 missense probably benign 0.01
R7983:Prkd2 UTSW 7 16853344 missense probably benign 0.01
X0062:Prkd2 UTSW 7 16855791 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCAGGTGCTAATTCGCTG -3'
(R):5'- ACTCCTAAGTCAGATTCTTGGTC -3'

Sequencing Primer
(F):5'- CAGGTGCTAATTCGCTGATCTG -3'
(R):5'- CTAAGTCAGATTCTTGGTCTTTCTAG -3'
Posted On2018-08-29