Incidental Mutation 'R6798:Olfr504'
ID533110
Institutional Source Beutler Lab
Gene Symbol Olfr504
Ensembl Gene ENSMUSG00000060105
Gene Nameolfactory receptor 504
SynonymsGA_x6K02T2PBJ9-10895499-10894543, MOR40-15, MOR40-7P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6798 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108564836-108565793 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 108565760 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 12 (K12*)
Ref Sequence ENSEMBL: ENSMUSP00000075025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075595]
Predicted Effect probably null
Transcript: ENSMUST00000075595
AA Change: K12*
SMART Domains Protein: ENSMUSP00000075025
Gene: ENSMUSG00000060105
AA Change: K12*

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.9e-70 PFAM
Pfam:7TM_GPCR_Srsx 40 311 5.1e-10 PFAM
Pfam:7tm_1 47 296 3.1e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310046K23Rik G C 3: 92,532,936 C65W unknown Het
Abcb1a T C 5: 8,732,364 Y916H probably damaging Het
Adam11 A G 11: 102,777,008 I740V probably damaging Het
Adam22 A T 5: 8,160,784 D161E probably damaging Het
Agap3 A G 5: 24,498,282 probably null Het
Ank2 T C 3: 126,944,264 probably benign Het
Aspm T A 1: 139,468,685 H867Q possibly damaging Het
Aurkaip1 T C 4: 155,832,739 probably null Het
BC048507 A C 13: 67,863,564 D20A probably benign Het
Cacna1a G A 8: 84,611,602 A1704T probably damaging Het
Cep152 A C 2: 125,566,527 probably null Het
Cep19 T C 16: 32,104,049 probably null Het
Chd9 A T 8: 91,051,554 E2731V possibly damaging Het
Chrd T C 16: 20,734,306 L139P probably damaging Het
Cit A G 5: 115,926,526 E489G possibly damaging Het
Clcn7 A G 17: 25,159,760 N720D probably damaging Het
Col6a3 T C 1: 90,795,009 probably null Het
Dchs2 T A 3: 83,348,286 Y2430N probably damaging Het
Dpy30 A G 17: 74,307,756 I64T probably damaging Het
Eif2b3 G T 4: 117,066,458 W290L probably benign Het
Epha6 T G 16: 60,605,064 E62A possibly damaging Het
Epha6 C T 16: 60,605,065 E62K possibly damaging Het
Epha8 C T 4: 136,945,669 R268Q probably benign Het
Fam155a G A 8: 9,770,205 Q272* probably null Het
Fbxw17 C A 13: 50,433,264 probably null Het
Fndc8 C T 11: 82,892,391 T66I probably benign Het
Frmpd1 A G 4: 45,284,850 T1224A probably benign Het
Gcm2 T C 13: 41,105,885 D36G probably damaging Het
Glt28d2 T C 3: 85,871,989 D59G probably benign Het
Gm4788 T C 1: 139,698,121 T813A probably benign Het
Gorasp1 T C 9: 119,929,597 D243G probably benign Het
Gtsf1l T C 2: 163,087,471 K31E probably benign Het
Heatr5a A G 12: 51,881,265 V1816A probably benign Het
Il10ra T C 9: 45,256,432 K274E probably damaging Het
Il1rl2 T C 1: 40,365,240 I507T probably damaging Het
Jak3 T G 8: 71,680,971 F408V probably damaging Het
Kdm1b A G 13: 47,068,536 T484A probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Map9 T G 3: 82,380,164 L31W probably damaging Het
Micalcl T C 7: 112,376,059 probably benign Het
Mt1 A G 8: 94,179,888 probably benign Het
Myo18b T C 5: 112,761,386 I1964V probably damaging Het
Nod1 A T 6: 54,944,611 C241S probably damaging Het
Nrxn1 T A 17: 90,629,950 D685V probably damaging Het
Olfr695 T C 7: 106,714,195 Y162C probably damaging Het
Olfr730 A G 14: 50,187,127 V30A probably benign Het
Olfr96 T G 17: 37,225,806 L227R probably damaging Het
Oog1 A T 12: 87,608,839 probably null Het
P4htm T A 9: 108,582,918 N219I possibly damaging Het
Pcif1 T C 2: 164,885,791 L168P possibly damaging Het
Pde4dip A G 3: 97,888,534 V46A probably benign Het
Pias1 T C 9: 62,892,169 T480A probably benign Het
Prkd2 A T 7: 16,849,203 K297* probably null Het
Prl7d1 T A 13: 27,709,397 probably null Het
Pxdc1 G T 13: 34,652,425 A4E possibly damaging Het
Rcor1 A G 12: 111,039,886 probably benign Het
Rev3l A T 10: 39,854,763 D2761V probably damaging Het
Scgb1b7 A G 7: 31,712,981 T61A probably damaging Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Setd4 C A 16: 93,589,953 V286F probably damaging Het
Slc22a29 A G 19: 8,160,604 S536P probably benign Het
Snx25 T C 8: 46,033,773 H977R probably damaging Het
Spint5 T A 2: 164,717,140 C95* probably null Het
Srgap1 T C 10: 121,925,904 D113G probably damaging Het
Stxbp2 T A 8: 3,641,180 S476T probably benign Het
Tg A G 15: 66,678,839 T273A probably damaging Het
Tnc C T 4: 63,965,604 R1868H probably benign Het
Trappc10 A G 10: 78,188,831 Y1155H probably benign Het
Trpm2 T A 10: 77,914,740 N1341Y probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfand1 T G 3: 10,346,176 K67T probably benign Het
Zfand4 A C 6: 116,328,253 K214Q probably benign Het
Zfp653 A T 9: 22,057,372 V465E probably damaging Het
Zswim8 A G 14: 20,715,992 Y782C probably damaging Het
Other mutations in Olfr504
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Olfr504 APN 7 108565202 missense probably benign 0.02
IGL01447:Olfr504 APN 7 108565009 missense possibly damaging 0.75
IGL01845:Olfr504 APN 7 108565136 missense possibly damaging 0.76
IGL02110:Olfr504 APN 7 108565079 missense probably damaging 1.00
IGL03196:Olfr504 APN 7 108564854 missense probably benign
R0282:Olfr504 UTSW 7 108565477 missense probably damaging 1.00
R0359:Olfr504 UTSW 7 108565514 missense probably benign 0.01
R0514:Olfr504 UTSW 7 108565672 missense probably damaging 1.00
R0727:Olfr504 UTSW 7 108565108 missense probably benign 0.00
R0744:Olfr504 UTSW 7 108564998 missense possibly damaging 0.57
R0836:Olfr504 UTSW 7 108564998 missense possibly damaging 0.57
R0840:Olfr504 UTSW 7 108565616 missense probably benign 0.00
R0883:Olfr504 UTSW 7 108565276 missense probably benign 0.01
R1750:Olfr504 UTSW 7 108565357 nonsense probably null
R1827:Olfr504 UTSW 7 108565075 missense probably benign 0.35
R1933:Olfr504 UTSW 7 108565523 missense possibly damaging 0.57
R3004:Olfr504 UTSW 7 108564944 missense probably benign 0.42
R3766:Olfr504 UTSW 7 108565195 missense probably benign 0.00
R5179:Olfr504 UTSW 7 108565226 missense probably benign
R5408:Olfr504 UTSW 7 108565169 missense probably damaging 0.99
R5493:Olfr504 UTSW 7 108565567 missense probably benign 0.24
R5569:Olfr504 UTSW 7 108565565 missense probably benign 0.01
R6520:Olfr504 UTSW 7 108564839 makesense probably null
R6803:Olfr504 UTSW 7 108565413 missense probably damaging 1.00
R7242:Olfr504 UTSW 7 108565712 missense probably benign 0.03
R7559:Olfr504 UTSW 7 108565556 missense probably damaging 0.99
R7644:Olfr504 UTSW 7 108565442 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGGTACATGGGCTGCTTCAG -3'
(R):5'- GACTTTCCAGTATGAACTACAACC -3'

Sequencing Primer
(F):5'- CTTCAGGGATGGATCCTGACAG -3'
(R):5'- TACAACCCCAGCTCCATTTTTAAG -3'
Posted On2018-08-29