Incidental Mutation 'R6798:Snx25'
ID533114
Institutional Source Beutler Lab
Gene Symbol Snx25
Ensembl Gene ENSMUSG00000038291
Gene Namesorting nexin 25
SynonymsLOC382008, SBBI31
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6798 (G1)
Quality Score119.008
Status Validated
Chromosome8
Chromosomal Location46033261-46152159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46033773 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 977 (H977R)
Ref Sequence ENSEMBL: ENSMUSP00000106007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041582] [ENSMUST00000110378] [ENSMUST00000110381] [ENSMUST00000170416]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041582
AA Change: H831R

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035785
Gene: ENSMUSG00000038291
AA Change: H831R

DomainStartEndE-ValueType
Pfam:PXA 1 163 9e-32 PFAM
RGS 287 401 6.62e-10 SMART
low complexity region 421 438 N/A INTRINSIC
PX 512 624 1.38e-10 SMART
low complexity region 658 663 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Nexin_C 701 808 1.7e-35 PFAM
low complexity region 812 828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110378
AA Change: H977R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106007
Gene: ENSMUSG00000038291
AA Change: H977R

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Pfam:PXA 145 306 8.7e-30 PFAM
RGS 433 547 6.62e-10 SMART
low complexity region 567 584 N/A INTRINSIC
PX 658 770 1.38e-10 SMART
low complexity region 804 809 N/A INTRINSIC
low complexity region 810 822 N/A INTRINSIC
Pfam:Nexin_C 847 953 1e-28 PFAM
low complexity region 958 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110381
SMART Domains Protein: ENSMUSP00000106010
Gene: ENSMUSG00000031637

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
SEL1 89 124 4.45e-3 SMART
SEL1 132 167 5.07e-7 SMART
SEL1 172 205 6.3e-3 SMART
SEL1 206 241 3.9e-8 SMART
Blast:SEL1 242 272 1e-5 BLAST
SEL1 296 331 7.57e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132341
Predicted Effect possibly damaging
Transcript: ENSMUST00000170416
AA Change: H831R

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127640
Gene: ENSMUSG00000038291
AA Change: H831R

DomainStartEndE-ValueType
Pfam:PXA 1 163 9e-32 PFAM
RGS 287 401 6.62e-10 SMART
low complexity region 421 438 N/A INTRINSIC
PX 512 624 1.38e-10 SMART
low complexity region 658 663 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Nexin_C 701 808 1.7e-35 PFAM
low complexity region 812 828 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177186
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310046K23Rik G C 3: 92,532,936 C65W unknown Het
Abcb1a T C 5: 8,732,364 Y916H probably damaging Het
Adam11 A G 11: 102,777,008 I740V probably damaging Het
Adam22 A T 5: 8,160,784 D161E probably damaging Het
Agap3 A G 5: 24,498,282 probably null Het
Ank2 T C 3: 126,944,264 probably benign Het
Aspm T A 1: 139,468,685 H867Q possibly damaging Het
Aurkaip1 T C 4: 155,832,739 probably null Het
BC048507 A C 13: 67,863,564 D20A probably benign Het
Cacna1a G A 8: 84,611,602 A1704T probably damaging Het
Cep152 A C 2: 125,566,527 probably null Het
Cep19 T C 16: 32,104,049 probably null Het
Chd9 A T 8: 91,051,554 E2731V possibly damaging Het
Chrd T C 16: 20,734,306 L139P probably damaging Het
Cit A G 5: 115,926,526 E489G possibly damaging Het
Clcn7 A G 17: 25,159,760 N720D probably damaging Het
Col6a3 T C 1: 90,795,009 probably null Het
Dchs2 T A 3: 83,348,286 Y2430N probably damaging Het
Dpy30 A G 17: 74,307,756 I64T probably damaging Het
Eif2b3 G T 4: 117,066,458 W290L probably benign Het
Epha6 T G 16: 60,605,064 E62A possibly damaging Het
Epha6 C T 16: 60,605,065 E62K possibly damaging Het
Epha8 C T 4: 136,945,669 R268Q probably benign Het
Fam155a G A 8: 9,770,205 Q272* probably null Het
Fbxw17 C A 13: 50,433,264 probably null Het
Fndc8 C T 11: 82,892,391 T66I probably benign Het
Frmpd1 A G 4: 45,284,850 T1224A probably benign Het
Gcm2 T C 13: 41,105,885 D36G probably damaging Het
Glt28d2 T C 3: 85,871,989 D59G probably benign Het
Gm4788 T C 1: 139,698,121 T813A probably benign Het
Gorasp1 T C 9: 119,929,597 D243G probably benign Het
Gtsf1l T C 2: 163,087,471 K31E probably benign Het
Heatr5a A G 12: 51,881,265 V1816A probably benign Het
Il10ra T C 9: 45,256,432 K274E probably damaging Het
Il1rl2 T C 1: 40,365,240 I507T probably damaging Het
Jak3 T G 8: 71,680,971 F408V probably damaging Het
Kdm1b A G 13: 47,068,536 T484A probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Map9 T G 3: 82,380,164 L31W probably damaging Het
Micalcl T C 7: 112,376,059 probably benign Het
Mt1 A G 8: 94,179,888 probably benign Het
Myo18b T C 5: 112,761,386 I1964V probably damaging Het
Nod1 A T 6: 54,944,611 C241S probably damaging Het
Nrxn1 T A 17: 90,629,950 D685V probably damaging Het
Olfr504 T A 7: 108,565,760 K12* probably null Het
Olfr695 T C 7: 106,714,195 Y162C probably damaging Het
Olfr730 A G 14: 50,187,127 V30A probably benign Het
Olfr96 T G 17: 37,225,806 L227R probably damaging Het
Oog1 A T 12: 87,608,839 probably null Het
P4htm T A 9: 108,582,918 N219I possibly damaging Het
Pcif1 T C 2: 164,885,791 L168P possibly damaging Het
Pde4dip A G 3: 97,888,534 V46A probably benign Het
Pias1 T C 9: 62,892,169 T480A probably benign Het
Prkd2 A T 7: 16,849,203 K297* probably null Het
Prl7d1 T A 13: 27,709,397 probably null Het
Pxdc1 G T 13: 34,652,425 A4E possibly damaging Het
Rcor1 A G 12: 111,039,886 probably benign Het
Rev3l A T 10: 39,854,763 D2761V probably damaging Het
Scgb1b7 A G 7: 31,712,981 T61A probably damaging Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Setd4 C A 16: 93,589,953 V286F probably damaging Het
Slc22a29 A G 19: 8,160,604 S536P probably benign Het
Spint5 T A 2: 164,717,140 C95* probably null Het
Srgap1 T C 10: 121,925,904 D113G probably damaging Het
Stxbp2 T A 8: 3,641,180 S476T probably benign Het
Tg A G 15: 66,678,839 T273A probably damaging Het
Tnc C T 4: 63,965,604 R1868H probably benign Het
Trappc10 A G 10: 78,188,831 Y1155H probably benign Het
Trpm2 T A 10: 77,914,740 N1341Y probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfand1 T G 3: 10,346,176 K67T probably benign Het
Zfand4 A C 6: 116,328,253 K214Q probably benign Het
Zfp653 A T 9: 22,057,372 V465E probably damaging Het
Zswim8 A G 14: 20,715,992 Y782C probably damaging Het
Other mutations in Snx25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Snx25 APN 8 46038476 missense probably damaging 1.00
IGL01432:Snx25 APN 8 46105160 missense probably damaging 0.96
IGL01600:Snx25 APN 8 46116310 missense probably benign 0.00
IGL02150:Snx25 APN 8 46116281 missense possibly damaging 0.89
IGL02386:Snx25 APN 8 46041349 missense possibly damaging 0.93
IGL02691:Snx25 APN 8 46105265 missense possibly damaging 0.88
IGL03338:Snx25 APN 8 46045210 missense probably benign 0.04
IGL03377:Snx25 APN 8 46080301 unclassified probably benign
duo UTSW 8 46124082 start codon destroyed probably null 0.88
R0047:Snx25 UTSW 8 46041365 missense probably damaging 0.99
R0047:Snx25 UTSW 8 46041365 missense probably damaging 0.99
R0048:Snx25 UTSW 8 46105109 splice site probably benign
R0048:Snx25 UTSW 8 46105109 splice site probably benign
R0056:Snx25 UTSW 8 46038513 missense probably damaging 1.00
R0546:Snx25 UTSW 8 46103630 missense probably benign 0.00
R0791:Snx25 UTSW 8 46124082 start codon destroyed probably null 0.88
R1165:Snx25 UTSW 8 46035715 missense probably damaging 0.99
R1255:Snx25 UTSW 8 46116238 missense probably benign 0.13
R1262:Snx25 UTSW 8 46105291 missense probably damaging 0.98
R1522:Snx25 UTSW 8 46124082 start codon destroyed probably null 0.88
R1652:Snx25 UTSW 8 46049473 missense probably damaging 0.99
R1710:Snx25 UTSW 8 46116207 missense possibly damaging 0.69
R1829:Snx25 UTSW 8 46035632 missense possibly damaging 0.82
R2090:Snx25 UTSW 8 46056113 missense probably damaging 1.00
R2158:Snx25 UTSW 8 46041407 missense probably damaging 1.00
R2906:Snx25 UTSW 8 46049523 intron probably null
R4244:Snx25 UTSW 8 46105254 missense probably damaging 0.98
R4394:Snx25 UTSW 8 46035678 missense probably damaging 1.00
R4465:Snx25 UTSW 8 46068229 missense possibly damaging 0.78
R4586:Snx25 UTSW 8 46116437 intron probably benign
R4663:Snx25 UTSW 8 46035579 missense probably damaging 1.00
R4961:Snx25 UTSW 8 46068192 missense probably damaging 0.99
R5104:Snx25 UTSW 8 46068166 makesense probably null
R5634:Snx25 UTSW 8 46041391 missense possibly damaging 0.94
R6128:Snx25 UTSW 8 46105203 missense probably benign 0.01
R6344:Snx25 UTSW 8 46035638 nonsense probably null
R6382:Snx25 UTSW 8 46055991 missense probably benign
R6523:Snx25 UTSW 8 46055855 missense probably damaging 0.96
R7143:Snx25 UTSW 8 46035715 missense possibly damaging 0.92
R7147:Snx25 UTSW 8 46105196 missense probably damaging 0.98
R7519:Snx25 UTSW 8 46116272 missense probably damaging 1.00
R7723:Snx25 UTSW 8 46038479 missense probably damaging 1.00
RF002:Snx25 UTSW 8 46116181 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTCACTTCACGTACAGCTAG -3'
(R):5'- ATATAACGTGGCAGGCGATTGG -3'

Sequencing Primer
(F):5'- CACTTCACGTACAGCTAGAGGGAG -3'
(R):5'- TCTCCTAGCATGGGATAAATCAGG -3'
Posted On2018-08-29