Incidental Mutation 'R6798:Epha6'
ID 533145
Institutional Source Beutler Lab
Gene Symbol Epha6
Ensembl Gene ENSMUSG00000055540
Gene Name Eph receptor A6
Synonyms m-ehk2, Hek12, Ehk2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6798 (G1)
Quality Score 129.008
Status Validated
Chromosome 16
Chromosomal Location 59653483-60605531 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 60605065 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 62 (E62K)
Ref Sequence ENSEMBL: ENSMUSP00000066734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068860]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000068860
AA Change: E62K

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: E62K

DomainStartEndE-ValueType
low complexity region 4 37 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
EPH_lbd 128 301 5.95e-125 SMART
Pfam:GCC2_GCC3 361 406 1.6e-8 PFAM
FN3 426 518 5.83e-3 SMART
FN3 537 618 2.19e-7 SMART
Pfam:EphA2_TM 644 722 1.8e-22 PFAM
TyrKc 725 1024 3.66e-122 SMART
SAM 1052 1119 1.24e-22 SMART
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 97% (73/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310046K23Rik G C 3: 92,532,936 C65W unknown Het
Abcb1a T C 5: 8,732,364 Y916H probably damaging Het
Adam11 A G 11: 102,777,008 I740V probably damaging Het
Adam22 A T 5: 8,160,784 D161E probably damaging Het
Agap3 A G 5: 24,498,282 probably null Het
Ank2 T C 3: 126,944,264 probably benign Het
Aspm T A 1: 139,468,685 H867Q possibly damaging Het
Aurkaip1 T C 4: 155,832,739 probably null Het
BC048507 A C 13: 67,863,564 D20A probably benign Het
Cacna1a G A 8: 84,611,602 A1704T probably damaging Het
Cep152 A C 2: 125,566,527 probably null Het
Cep19 T C 16: 32,104,049 probably null Het
Chd9 A T 8: 91,051,554 E2731V possibly damaging Het
Chrd T C 16: 20,734,306 L139P probably damaging Het
Cit A G 5: 115,926,526 E489G possibly damaging Het
Clcn7 A G 17: 25,159,760 N720D probably damaging Het
Col6a3 T C 1: 90,795,009 probably null Het
Dchs2 T A 3: 83,348,286 Y2430N probably damaging Het
Dpy30 A G 17: 74,307,756 I64T probably damaging Het
Eif2b3 G T 4: 117,066,458 W290L probably benign Het
Epha8 C T 4: 136,945,669 R268Q probably benign Het
Fam155a G A 8: 9,770,205 Q272* probably null Het
Fbxw17 C A 13: 50,433,264 probably null Het
Fndc8 C T 11: 82,892,391 T66I probably benign Het
Frmpd1 A G 4: 45,284,850 T1224A probably benign Het
Gcm2 T C 13: 41,105,885 D36G probably damaging Het
Glt28d2 T C 3: 85,871,989 D59G probably benign Het
Gm4788 T C 1: 139,698,121 T813A probably benign Het
Gorasp1 T C 9: 119,929,597 D243G probably benign Het
Gtsf1l T C 2: 163,087,471 K31E probably benign Het
Heatr5a A G 12: 51,881,265 V1816A probably benign Het
Il10ra T C 9: 45,256,432 K274E probably damaging Het
Il1rl2 T C 1: 40,365,240 I507T probably damaging Het
Jak3 T G 8: 71,680,971 F408V probably damaging Het
Kdm1b A G 13: 47,068,536 T484A probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Map9 T G 3: 82,380,164 L31W probably damaging Het
Micalcl T C 7: 112,376,059 probably benign Het
Mt1 A G 8: 94,179,888 probably benign Het
Myo18b T C 5: 112,761,386 I1964V probably damaging Het
Nod1 A T 6: 54,944,611 C241S probably damaging Het
Nrxn1 T A 17: 90,629,950 D685V probably damaging Het
Olfr504 T A 7: 108,565,760 K12* probably null Het
Olfr695 T C 7: 106,714,195 Y162C probably damaging Het
Olfr730 A G 14: 50,187,127 V30A probably benign Het
Olfr96 T G 17: 37,225,806 L227R probably damaging Het
Oog1 A T 12: 87,608,839 probably null Het
P4htm T A 9: 108,582,918 N219I possibly damaging Het
Pcif1 T C 2: 164,885,791 L168P possibly damaging Het
Pde4dip A G 3: 97,888,534 V46A probably benign Het
Pias1 T C 9: 62,892,169 T480A probably benign Het
Prkd2 A T 7: 16,849,203 K297* probably null Het
Prl7d1 T A 13: 27,709,397 probably null Het
Pxdc1 G T 13: 34,652,425 A4E possibly damaging Het
Rcor1 A G 12: 111,039,886 probably benign Het
Rev3l A T 10: 39,854,763 D2761V probably damaging Het
Scgb1b7 A G 7: 31,712,981 T61A probably damaging Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Setd4 C A 16: 93,589,953 V286F probably damaging Het
Slc22a29 A G 19: 8,160,604 S536P probably benign Het
Snx25 T C 8: 46,033,773 H977R probably damaging Het
Spint5 T A 2: 164,717,140 C95* probably null Het
Srgap1 T C 10: 121,925,904 D113G probably damaging Het
Stxbp2 T A 8: 3,641,180 S476T probably benign Het
Tg A G 15: 66,678,839 T273A probably damaging Het
Tnc C T 4: 63,965,604 R1868H probably benign Het
Trappc10 A G 10: 78,188,831 Y1155H probably benign Het
Trpm2 T A 10: 77,914,740 N1341Y probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfand1 T G 3: 10,346,176 K67T probably benign Het
Zfand4 A C 6: 116,328,253 K214Q probably benign Het
Zfp653 A T 9: 22,057,372 V465E probably damaging Het
Zswim8 A G 14: 20,715,992 Y782C probably damaging Het
Other mutations in Epha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Epha6 APN 16 59915962 missense probably damaging 1.00
IGL00849:Epha6 APN 16 60425111 missense possibly damaging 0.89
IGL00898:Epha6 APN 16 59775541 critical splice donor site probably null
IGL01353:Epha6 APN 16 60424895 missense probably damaging 1.00
IGL01409:Epha6 APN 16 59655737 nonsense probably null
IGL01577:Epha6 APN 16 59956926 missense possibly damaging 0.57
IGL01653:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01654:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01655:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01657:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01663:Epha6 APN 16 59775644 missense probably damaging 1.00
IGL01899:Epha6 APN 16 59839303 missense probably benign 0.05
IGL02272:Epha6 APN 16 59818937 missense probably damaging 1.00
IGL03265:Epha6 APN 16 60060231 splice site probably benign
IGL03333:Epha6 APN 16 59682688 missense probably damaging 1.00
rauwulfia UTSW 16 59682616 missense probably damaging 1.00
PIT4377001:Epha6 UTSW 16 60205552 missense probably damaging 0.98
R0505:Epha6 UTSW 16 60205732 missense possibly damaging 0.89
R1593:Epha6 UTSW 16 60424904 missense probably damaging 1.00
R1764:Epha6 UTSW 16 59775728 missense probably null 1.00
R1836:Epha6 UTSW 16 60205745 missense probably damaging 1.00
R2061:Epha6 UTSW 16 59655797 missense probably damaging 1.00
R2125:Epha6 UTSW 16 59682688 missense probably damaging 1.00
R2867:Epha6 UTSW 16 59960296 splice site probably null
R2867:Epha6 UTSW 16 59960296 splice site probably null
R3760:Epha6 UTSW 16 60220984 missense possibly damaging 0.70
R4305:Epha6 UTSW 16 60526520 splice site probably null
R4613:Epha6 UTSW 16 59666597 missense possibly damaging 0.80
R4818:Epha6 UTSW 16 59654063 missense probably damaging 0.99
R4832:Epha6 UTSW 16 59960413 missense probably damaging 0.98
R4895:Epha6 UTSW 16 59666555 missense probably benign 0.08
R5014:Epha6 UTSW 16 59666579 missense probably benign 0.00
R5316:Epha6 UTSW 16 59954720 missense probably damaging 0.99
R5403:Epha6 UTSW 16 59775570 missense probably damaging 1.00
R5417:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5418:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5678:Epha6 UTSW 16 59818979 missense probably damaging 1.00
R5775:Epha6 UTSW 16 59818994 missense possibly damaging 0.92
R5808:Epha6 UTSW 16 59682742 missense probably damaging 1.00
R6076:Epha6 UTSW 16 60205710 missense probably damaging 1.00
R6146:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6212:Epha6 UTSW 16 60425356 missense possibly damaging 0.77
R6242:Epha6 UTSW 16 59682662 missense probably damaging 1.00
R6503:Epha6 UTSW 16 60205621 missense possibly damaging 0.61
R6580:Epha6 UTSW 16 59682616 missense probably damaging 1.00
R6726:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6728:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6798:Epha6 UTSW 16 60605064 missense possibly damaging 0.53
R6903:Epha6 UTSW 16 60526462 missense probably benign 0.00
R6999:Epha6 UTSW 16 60425170 missense possibly damaging 0.94
R7058:Epha6 UTSW 16 59682650 missense probably damaging 1.00
R7109:Epha6 UTSW 16 59682668 missense probably damaging 1.00
R7263:Epha6 UTSW 16 59775665 missense probably damaging 1.00
R7296:Epha6 UTSW 16 59915838 missense probably benign 0.00
R7343:Epha6 UTSW 16 59960430 missense probably damaging 0.98
R7443:Epha6 UTSW 16 59775625 missense possibly damaging 0.93
R7533:Epha6 UTSW 16 60205562 missense probably damaging 1.00
R7602:Epha6 UTSW 16 59775568 missense probably damaging 1.00
R7604:Epha6 UTSW 16 60205772 missense possibly damaging 0.89
R8321:Epha6 UTSW 16 59915954 missense probably damaging 1.00
R8414:Epha6 UTSW 16 60005667 missense probably damaging 1.00
R8794:Epha6 UTSW 16 60205672 missense probably benign 0.00
R8926:Epha6 UTSW 16 59839299 missense probably benign 0.11
R9166:Epha6 UTSW 16 60604875 missense probably benign 0.00
R9265:Epha6 UTSW 16 59655754 missense probably damaging 1.00
R9322:Epha6 UTSW 16 60424755 missense probably damaging 1.00
Z1188:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Z1189:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTACCTTGGTTGGAGACG -3'
(R):5'- ACGGTGGTGGATGCAATTCC -3'

Sequencing Primer
(F):5'- TGGAGACGTGACTGCAGTC -3'
(R):5'- TGGTGGATGCAATTCCCCTCG -3'
Posted On 2018-08-29