Incidental Mutation 'R6798:Olfr96'
ID533149
Institutional Source Beutler Lab
Gene Symbol Olfr96
Ensembl Gene ENSMUSG00000064121
Gene Nameolfactory receptor 96
SynonymsGA_x6K02T2PSCP-1665046-1665987, MOR121-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6798 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37220146-37226673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 37225806 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 227 (L227R)
Ref Sequence ENSEMBL: ENSMUSP00000151151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078209] [ENSMUST00000213475] [ENSMUST00000214482]
Predicted Effect probably damaging
Transcript: ENSMUST00000078209
AA Change: L227R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077338
Gene: ENSMUSG00000064121
AA Change: L227R

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.6e-53 PFAM
Pfam:7tm_1 43 291 6.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213475
AA Change: L227R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214482
AA Change: L227R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5553 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310046K23Rik G C 3: 92,532,936 C65W unknown Het
Abcb1a T C 5: 8,732,364 Y916H probably damaging Het
Adam11 A G 11: 102,777,008 I740V probably damaging Het
Adam22 A T 5: 8,160,784 D161E probably damaging Het
Agap3 A G 5: 24,498,282 probably null Het
Ank2 T C 3: 126,944,264 probably benign Het
Aspm T A 1: 139,468,685 H867Q possibly damaging Het
Aurkaip1 T C 4: 155,832,739 probably null Het
BC048507 A C 13: 67,863,564 D20A probably benign Het
Cacna1a G A 8: 84,611,602 A1704T probably damaging Het
Cep152 A C 2: 125,566,527 probably null Het
Cep19 T C 16: 32,104,049 probably null Het
Chd9 A T 8: 91,051,554 E2731V possibly damaging Het
Chrd T C 16: 20,734,306 L139P probably damaging Het
Cit A G 5: 115,926,526 E489G possibly damaging Het
Clcn7 A G 17: 25,159,760 N720D probably damaging Het
Col6a3 T C 1: 90,795,009 probably null Het
Dchs2 T A 3: 83,348,286 Y2430N probably damaging Het
Dpy30 A G 17: 74,307,756 I64T probably damaging Het
Eif2b3 G T 4: 117,066,458 W290L probably benign Het
Epha6 T G 16: 60,605,064 E62A possibly damaging Het
Epha6 C T 16: 60,605,065 E62K possibly damaging Het
Epha8 C T 4: 136,945,669 R268Q probably benign Het
Fam155a G A 8: 9,770,205 Q272* probably null Het
Fbxw17 C A 13: 50,433,264 probably null Het
Fndc8 C T 11: 82,892,391 T66I probably benign Het
Frmpd1 A G 4: 45,284,850 T1224A probably benign Het
Gcm2 T C 13: 41,105,885 D36G probably damaging Het
Glt28d2 T C 3: 85,871,989 D59G probably benign Het
Gm4788 T C 1: 139,698,121 T813A probably benign Het
Gorasp1 T C 9: 119,929,597 D243G probably benign Het
Gtsf1l T C 2: 163,087,471 K31E probably benign Het
Heatr5a A G 12: 51,881,265 V1816A probably benign Het
Il10ra T C 9: 45,256,432 K274E probably damaging Het
Il1rl2 T C 1: 40,365,240 I507T probably damaging Het
Jak3 T G 8: 71,680,971 F408V probably damaging Het
Kdm1b A G 13: 47,068,536 T484A probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Map9 T G 3: 82,380,164 L31W probably damaging Het
Micalcl T C 7: 112,376,059 probably benign Het
Mt1 A G 8: 94,179,888 probably benign Het
Myo18b T C 5: 112,761,386 I1964V probably damaging Het
Nod1 A T 6: 54,944,611 C241S probably damaging Het
Nrxn1 T A 17: 90,629,950 D685V probably damaging Het
Olfr504 T A 7: 108,565,760 K12* probably null Het
Olfr695 T C 7: 106,714,195 Y162C probably damaging Het
Olfr730 A G 14: 50,187,127 V30A probably benign Het
Oog1 A T 12: 87,608,839 probably null Het
P4htm T A 9: 108,582,918 N219I possibly damaging Het
Pcif1 T C 2: 164,885,791 L168P possibly damaging Het
Pde4dip A G 3: 97,888,534 V46A probably benign Het
Pias1 T C 9: 62,892,169 T480A probably benign Het
Prkd2 A T 7: 16,849,203 K297* probably null Het
Prl7d1 T A 13: 27,709,397 probably null Het
Pxdc1 G T 13: 34,652,425 A4E possibly damaging Het
Rcor1 A G 12: 111,039,886 probably benign Het
Rev3l A T 10: 39,854,763 D2761V probably damaging Het
Scgb1b7 A G 7: 31,712,981 T61A probably damaging Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Setd4 C A 16: 93,589,953 V286F probably damaging Het
Slc22a29 A G 19: 8,160,604 S536P probably benign Het
Snx25 T C 8: 46,033,773 H977R probably damaging Het
Spint5 T A 2: 164,717,140 C95* probably null Het
Srgap1 T C 10: 121,925,904 D113G probably damaging Het
Stxbp2 T A 8: 3,641,180 S476T probably benign Het
Tg A G 15: 66,678,839 T273A probably damaging Het
Tnc C T 4: 63,965,604 R1868H probably benign Het
Trappc10 A G 10: 78,188,831 Y1155H probably benign Het
Trpm2 T A 10: 77,914,740 N1341Y probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfand1 T G 3: 10,346,176 K67T probably benign Het
Zfand4 A C 6: 116,328,253 K214Q probably benign Het
Zfp653 A T 9: 22,057,372 V465E probably damaging Het
Zswim8 A G 14: 20,715,992 Y782C probably damaging Het
Other mutations in Olfr96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Olfr96 APN 17 37225152 missense probably benign 0.05
IGL02151:Olfr96 APN 17 37225166 missense probably damaging 1.00
IGL02335:Olfr96 APN 17 37225326 missense probably damaging 0.97
R0360:Olfr96 UTSW 17 37226043 missense possibly damaging 0.49
R0364:Olfr96 UTSW 17 37226043 missense possibly damaging 0.49
R1763:Olfr96 UTSW 17 37225430 missense probably benign 0.02
R3977:Olfr96 UTSW 17 37225158 missense probably benign 0.24
R6116:Olfr96 UTSW 17 37225568 missense probably benign 0.00
R6248:Olfr96 UTSW 17 37225560 nonsense probably null
R6378:Olfr96 UTSW 17 37225797 missense probably benign 0.21
R6518:Olfr96 UTSW 17 37225268 missense probably benign 0.05
R6614:Olfr96 UTSW 17 37225899 missense probably benign 0.01
R6874:Olfr96 UTSW 17 37225347 missense probably benign 0.00
R7468:Olfr96 UTSW 17 37225385 missense probably benign 0.01
R7820:Olfr96 UTSW 17 37225895 missense probably benign 0.00
R7852:Olfr96 UTSW 17 37225272 missense probably benign 0.01
R7935:Olfr96 UTSW 17 37225272 missense probably benign 0.01
X0027:Olfr96 UTSW 17 37225743 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATGGCCCAGTTGAGATTCTG -3'
(R):5'- CCTGGTTCCTCAAGGTGTAG -3'

Sequencing Primer
(F):5'- GAGATTCTGTGGCCCCAACTTAG -3'
(R):5'- TTCCTCAAGGTGTAGATGACAG -3'
Posted On2018-08-29