Incidental Mutation 'R6354:Odf3'
ID533156
Institutional Source Beutler Lab
Gene Symbol Odf3
Ensembl Gene ENSMUSG00000025482
Gene Nameouter dense fiber of sperm tails 3
Synonyms1700011O04Rik, SHIPPO1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6354 (G1)
Quality Score218.009
Status Validated
Chromosome7
Chromosomal Location140847805-140851018 bp(+) (GRCm38)
Type of Mutationsplice site (3910 bp from exon)
DNA Base Change (assembly) A to G at 140850614 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148146 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000209690
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ODF3 is a component of sperm flagella outer dense fibers, which add stiffness, elastic recoil, and protection against shearing forces during sperm movement.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,794,216 K152E probably benign Het
Adamts20 C A 15: 94,347,810 C537F probably damaging Het
Apc A T 18: 34,312,528 T808S probably benign Het
Atad3a A G 4: 155,753,945 I205T possibly damaging Het
Casz1 G T 4: 148,952,542 G1754C unknown Het
Ccdc62 C T 5: 123,944,204 A232V probably damaging Het
Cdc27 C A 11: 104,534,748 D81Y probably damaging Het
Cep126 A G 9: 8,099,927 S869P probably damaging Het
Ciita A T 16: 10,523,746 K983N probably damaging Het
Clstn1 A C 4: 149,643,216 Q523P probably benign Het
Cpb2 T C 14: 75,257,705 probably null Het
Crybg2 A G 4: 134,091,136 D1710G probably benign Het
Csmd3 C T 15: 47,881,489 G1370D probably damaging Het
Cwf19l1 G T 19: 44,127,473 D172E probably benign Het
Cyp4a14 A G 4: 115,487,244 F475L probably damaging Het
Fam98c C T 7: 29,152,847 V298M probably damaging Het
Gcsh T C 8: 116,983,843 N127S probably benign Het
Gimap4 T C 6: 48,686,880 F10S possibly damaging Het
Gm4787 C T 12: 81,377,981 A468T probably damaging Het
Gm5111 G A 6: 48,590,334 probably benign Het
Gm7137 C A 10: 77,787,647 probably benign Het
Inpp1 A G 1: 52,797,065 S81P probably damaging Het
Iqce T C 5: 140,676,335 probably null Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Krtap13 C A 16: 88,751,243 C119F probably damaging Het
Lama2 G T 10: 27,212,068 D904E probably damaging Het
Lrrc37a T A 11: 103,464,387 I2535F unknown Het
Lrrc40 T A 3: 158,061,264 L452* probably null Het
Meis1 A T 11: 19,016,184 M63K possibly damaging Het
Mpo T A 11: 87,797,346 I277N possibly damaging Het
Mtmr11 T A 3: 96,168,676 F406I probably benign Het
Muc4 T C 16: 32,754,358 S1411P probably benign Het
Olfr10 A T 11: 49,317,638 I31F probably damaging Het
Olfr1189 T A 2: 88,592,134 I110N probably damaging Het
Olfr683 G A 7: 105,143,708 T195I probably benign Het
Phf21a G A 2: 92,348,937 G298R probably damaging Het
Phldb2 T C 16: 45,825,114 Y368C probably damaging Het
Pik3cb G T 9: 99,073,643 T407K probably benign Het
Robo3 A T 9: 37,417,217 probably benign Het
Sgsm1 T G 5: 113,282,656 T288P probably damaging Het
Slc5a7 A G 17: 54,277,033 S410P probably damaging Het
Tmc6 A C 11: 117,774,236 C404G probably benign Het
Tnrc6c A T 11: 117,749,614 Q1410L possibly damaging Het
Trak1 A T 9: 121,451,726 T384S probably null Het
Txlna A T 4: 129,634,412 L244Q probably damaging Het
Ube3c T C 5: 29,663,583 F939L probably damaging Het
Vmn2r65 T A 7: 84,940,366 I781F probably benign Het
Vmn2r72 A G 7: 85,750,539 probably null Het
Vps36 T C 8: 22,205,755 S109P probably damaging Het
Wdr66 C T 5: 123,302,755 T1125I probably damaging Het
Wrn T C 8: 33,343,638 I82M possibly damaging Het
Zbtb49 T C 5: 38,203,559 R511G possibly damaging Het
Zeb1 A G 18: 5,772,743 T1011A possibly damaging Het
Zfhx4 T C 3: 5,401,951 S2390P probably benign Het
Zfp619 C A 7: 39,534,819 T91K probably benign Het
Zfp644 A G 5: 106,636,753 S643P probably benign Het
Other mutations in Odf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0051:Odf3 UTSW 7 140850221 unclassified probably benign
R0547:Odf3 UTSW 7 140848815 splice site probably null
R0981:Odf3 UTSW 7 140848295 missense probably benign 0.00
R1221:Odf3 UTSW 7 140848383 missense probably damaging 1.00
R2849:Odf3 UTSW 7 140849269 missense probably benign 0.00
R4833:Odf3 UTSW 7 140848278 start codon destroyed probably null
R4854:Odf3 UTSW 7 140849462 missense probably damaging 1.00
R4896:Odf3 UTSW 7 140848485 intron probably benign
R5109:Odf3 UTSW 7 140849548 missense probably benign 0.11
R6110:Odf3 UTSW 7 140848641 missense possibly damaging 0.73
R6441:Odf3 UTSW 7 140849248 missense probably damaging 1.00
R6516:Odf3 UTSW 7 140848805 missense probably damaging 0.99
R6672:Odf3 UTSW 7 140848427 missense probably benign 0.27
R7086:Odf3 UTSW 7 140849489 missense probably benign
R7820:Odf3 UTSW 7 140849263 missense probably benign 0.44
R8069:Odf3 UTSW 7 140850302 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCTAGGGAAGGCCTACACTCTG -3'
(R):5'- TGTGGGAGGATCGTAGTCAC -3'

Sequencing Primer
(F):5'- GCAAGTGTGTGCGGGGTG -3'
(R):5'- GCAGAGGCTATTCCACATCG -3'
Posted On2018-09-04