Incidental Mutation 'R6799:Epha8'
ID533191
Institutional Source Beutler Lab
Gene Symbol Epha8
Ensembl Gene ENSMUSG00000028661
Gene NameEph receptor A8
SynonymsEphA8, Hek3, Eek
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6799 (G1)
Quality Score194.009
Status Not validated
Chromosome4
Chromosomal Location136929419-136956816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 136945669 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 268 (R268Q)
Ref Sequence ENSEMBL: ENSMUSP00000030420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030420]
Predicted Effect probably benign
Transcript: ENSMUST00000030420
AA Change: R268Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030420
Gene: ENSMUSG00000028661
AA Change: R268Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 30 203 2.59e-116 SMART
FN3 328 418 4.03e-6 SMART
FN3 439 520 1.67e-12 SMART
Pfam:EphA2_TM 542 631 5.8e-10 PFAM
TyrKc 634 891 1.03e-125 SMART
SAM 926 993 4.74e-19 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and grossly normal but exhibit a commissural defect, whereby tectal axons fail to project from the superior colliculus of the midbrain to the contralateral inferior colliculus and instead project to the ipsilateral cervical spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A T 5: 145,044,814 Y153F probably damaging Het
5830473C10Rik A G 5: 90,579,615 H364R probably damaging Het
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Anapc1 C G 2: 128,659,737 R795T probably null Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Arhgap26 A G 18: 39,099,607 N96D probably damaging Het
Asxl3 G T 18: 22,465,400 E191* probably null Het
Cc2d2b A G 19: 40,791,208 E697G possibly damaging Het
Chaf1a A T 17: 56,047,059 I110F unknown Het
Clca4b A T 3: 144,915,627 probably null Het
Dagla C A 19: 10,256,850 V366L probably damaging Het
Dapk1 A G 13: 60,752,235 N878S probably benign Het
Dapk3 A G 10: 81,190,262 Y129C probably damaging Het
Dhx38 A G 8: 109,553,202 L952P probably damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dscaml1 G A 9: 45,450,583 V214I probably benign Het
Dtymk A G 1: 93,798,492 L15P probably benign Het
E330034G19Rik A G 14: 24,296,110 M30V probably benign Het
Egfr G A 11: 16,896,952 C783Y probably damaging Het
Fbxw24 T A 9: 109,624,930 R49S probably damaging Het
Fuk T C 8: 110,893,418 M276V probably benign Het
Gm8797 A T 3: 5,750,967 T22S probably benign Het
Hao1 T C 2: 134,530,765 S108G probably damaging Het
Hdac4 C A 1: 92,002,213 A184S probably damaging Het
Hikeshi T A 7: 89,930,345 probably benign Het
Hivep2 C T 10: 14,129,013 R452C probably benign Het
Hsdl1 T C 8: 119,566,430 S68G probably benign Het
Kctd20 T C 17: 28,963,377 probably null Het
Klf11 T C 12: 24,655,639 V364A possibly damaging Het
Kpna6 A G 4: 129,657,454 L86P probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lpin1 T A 12: 16,561,044 N516Y probably damaging Het
Lrp2 T C 2: 69,483,904 Y2161C probably damaging Het
Lrrtm3 A T 10: 64,087,851 C512* probably null Het
Mfsd1 T C 3: 67,599,981 I405T probably damaging Het
Msc T G 1: 14,755,267 D161A probably damaging Het
Mttp T C 3: 138,095,080 I755V probably benign Het
Ncam1 T C 9: 49,508,611 T803A probably damaging Het
Nlrp14 A G 7: 107,196,139 I210V probably benign Het
Npat A T 9: 53,551,630 H108L probably benign Het
Nt5dc1 A G 10: 34,313,707 I329T possibly damaging Het
Olfr1417 T A 19: 11,828,814 I71F possibly damaging Het
Olfr638 T A 7: 103,998,799 probably null Het
Olfr881 T C 9: 37,993,182 L230P possibly damaging Het
Parm1 C T 5: 91,594,211 T146I possibly damaging Het
Parp2 T C 14: 50,821,096 Y528H probably damaging Het
Pias1 G T 9: 62,882,052 S624R probably benign Het
Ppif A G 14: 25,696,064 H95R probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Psg20 A G 7: 18,684,420 Y141H probably benign Het
Pygm A T 19: 6,398,127 Y733F probably damaging Het
Rcc1l A T 5: 134,176,713 M1K probably null Het
Rfpl4b T C 10: 38,821,345 K87E possibly damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Scn5a A C 9: 119,495,622 I1380S possibly damaging Het
Sel1l A G 12: 91,814,968 probably null Het
Slc18a1 T A 8: 69,040,981 I400L probably benign Het
Slc30a3 A G 5: 31,089,614 S73P probably damaging Het
Slc9a5 A T 8: 105,363,968 N685I possibly damaging Het
Tnc C T 4: 63,965,604 R1868H probably benign Het
Trdmt1 A G 2: 13,516,013 probably null Het
Ttyh1 G T 7: 4,133,222 probably null Het
Tyms A T 5: 30,061,071 D283E probably benign Het
Vmn2r110 T A 17: 20,583,536 Y259F probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r88 C A 14: 51,413,969 Q255K probably benign Het
Vmn2r95 C T 17: 18,439,293 P100S probably damaging Het
Zfp128 A T 7: 12,890,899 H398L possibly damaging Het
Other mutations in Epha8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Epha8 APN 4 136945810 missense probably damaging 1.00
IGL00960:Epha8 APN 4 136951839 splice site probably null
IGL01124:Epha8 APN 4 136936083 missense probably damaging 1.00
IGL01550:Epha8 APN 4 136931740 missense possibly damaging 0.87
IGL01807:Epha8 APN 4 136931682 missense probably benign 0.08
IGL01844:Epha8 APN 4 136931049 makesense probably null
IGL02167:Epha8 APN 4 136931094 missense probably damaging 1.00
R0255:Epha8 UTSW 4 136940286 missense probably damaging 0.99
R0445:Epha8 UTSW 4 136932400 missense probably damaging 1.00
R1757:Epha8 UTSW 4 136931478 splice site probably null
R1911:Epha8 UTSW 4 136936314 missense probably damaging 1.00
R1936:Epha8 UTSW 4 136940243 missense probably benign 0.08
R2291:Epha8 UTSW 4 136933347 missense probably damaging 1.00
R2359:Epha8 UTSW 4 136946032 missense probably damaging 1.00
R2372:Epha8 UTSW 4 136933010 missense probably damaging 1.00
R4581:Epha8 UTSW 4 136933464 missense probably damaging 1.00
R4747:Epha8 UTSW 4 136938695 frame shift probably null
R4784:Epha8 UTSW 4 136933322 missense probably damaging 1.00
R5156:Epha8 UTSW 4 136938726 missense probably benign 0.14
R5164:Epha8 UTSW 4 136945672 missense possibly damaging 0.93
R5335:Epha8 UTSW 4 136931935 missense probably damaging 1.00
R5480:Epha8 UTSW 4 136935130 missense probably benign
R5552:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R5830:Epha8 UTSW 4 136936390 nonsense probably null
R6017:Epha8 UTSW 4 136931743 missense probably damaging 1.00
R6450:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R6798:Epha8 UTSW 4 136945669 missense probably benign 0.00
R7060:Epha8 UTSW 4 136931158 missense probably damaging 1.00
R7297:Epha8 UTSW 4 136945913 missense probably damaging 1.00
R7344:Epha8 UTSW 4 136934538 missense probably benign 0.14
R7467:Epha8 UTSW 4 136931088 missense possibly damaging 0.90
R7563:Epha8 UTSW 4 136938789 missense possibly damaging 0.77
R7826:Epha8 UTSW 4 136936187 missense probably benign 0.09
R7845:Epha8 UTSW 4 136936401 missense probably benign 0.04
R7863:Epha8 UTSW 4 136933655 missense probably damaging 1.00
R7904:Epha8 UTSW 4 136931739 missense possibly damaging 0.95
R7918:Epha8 UTSW 4 136934566 missense probably benign 0.12
R8177:Epha8 UTSW 4 136945663 missense probably benign 0.00
R8244:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8266:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8268:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8269:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8289:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8290:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8294:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8295:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8299:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8445:Epha8 UTSW 4 136932289 missense probably benign 0.13
RF025:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
RF054:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
Z1176:Epha8 UTSW 4 136938696 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTTTGACAATGTCATGGGAC -3'
(R):5'- CTACTACAAGAAGTGCCCCG -3'

Sequencing Primer
(F):5'- GTCATGGGACGGGCCAC -3'
(R):5'- AAGAAGTGCCCCGCCATG -3'
Posted On2018-09-12