Incidental Mutation 'R6799:1700018F24Rik'
ID533198
Institutional Source Beutler Lab
Gene Symbol 1700018F24Rik
Ensembl Gene ENSMUSG00000029620
Gene NameRIKEN cDNA 1700018F24 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6799 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location145042990-145045681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 145044814 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 153 (Y153F)
Ref Sequence ENSEMBL: ENSMUSP00000031624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031624] [ENSMUST00000151196]
Predicted Effect probably damaging
Transcript: ENSMUST00000031624
AA Change: Y153F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031624
Gene: ENSMUSG00000029620
AA Change: Y153F

DomainStartEndE-ValueType
Pfam:RasGEF_N 62 153 2.9e-10 PFAM
low complexity region 166 186 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
low complexity region 260 286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151196
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,579,615 H364R probably damaging Het
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Anapc1 C G 2: 128,659,737 R795T probably null Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Arhgap26 A G 18: 39,099,607 N96D probably damaging Het
Asxl3 G T 18: 22,465,400 E191* probably null Het
Cc2d2b A G 19: 40,791,208 E697G possibly damaging Het
Chaf1a A T 17: 56,047,059 I110F unknown Het
Clca4b A T 3: 144,915,627 probably null Het
Dagla C A 19: 10,256,850 V366L probably damaging Het
Dapk1 A G 13: 60,752,235 N878S probably benign Het
Dapk3 A G 10: 81,190,262 Y129C probably damaging Het
Dhx38 A G 8: 109,553,202 L952P probably damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dscaml1 G A 9: 45,450,583 V214I probably benign Het
Dtymk A G 1: 93,798,492 L15P probably benign Het
E330034G19Rik A G 14: 24,296,110 M30V probably benign Het
Egfr G A 11: 16,896,952 C783Y probably damaging Het
Epha8 C T 4: 136,945,669 R268Q probably benign Het
Fbxw24 T A 9: 109,624,930 R49S probably damaging Het
Fuk T C 8: 110,893,418 M276V probably benign Het
Gm8797 A T 3: 5,750,967 T22S probably benign Het
Hao1 T C 2: 134,530,765 S108G probably damaging Het
Hdac4 C A 1: 92,002,213 A184S probably damaging Het
Hikeshi T A 7: 89,930,345 probably benign Het
Hivep2 C T 10: 14,129,013 R452C probably benign Het
Hsdl1 T C 8: 119,566,430 S68G probably benign Het
Kctd20 T C 17: 28,963,377 probably null Het
Klf11 T C 12: 24,655,639 V364A possibly damaging Het
Kpna6 A G 4: 129,657,454 L86P probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lpin1 T A 12: 16,561,044 N516Y probably damaging Het
Lrp2 T C 2: 69,483,904 Y2161C probably damaging Het
Lrrtm3 A T 10: 64,087,851 C512* probably null Het
Mfsd1 T C 3: 67,599,981 I405T probably damaging Het
Msc T G 1: 14,755,267 D161A probably damaging Het
Mttp T C 3: 138,095,080 I755V probably benign Het
Ncam1 T C 9: 49,508,611 T803A probably damaging Het
Nlrp14 A G 7: 107,196,139 I210V probably benign Het
Npat A T 9: 53,551,630 H108L probably benign Het
Nt5dc1 A G 10: 34,313,707 I329T possibly damaging Het
Olfr1417 T A 19: 11,828,814 I71F possibly damaging Het
Olfr638 T A 7: 103,998,799 probably null Het
Olfr881 T C 9: 37,993,182 L230P possibly damaging Het
Parm1 C T 5: 91,594,211 T146I possibly damaging Het
Parp2 T C 14: 50,821,096 Y528H probably damaging Het
Pias1 G T 9: 62,882,052 S624R probably benign Het
Ppif A G 14: 25,696,064 H95R probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Psg20 A G 7: 18,684,420 Y141H probably benign Het
Pygm A T 19: 6,398,127 Y733F probably damaging Het
Rcc1l A T 5: 134,176,713 M1K probably null Het
Rfpl4b T C 10: 38,821,345 K87E possibly damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Scn5a A C 9: 119,495,622 I1380S possibly damaging Het
Sel1l A G 12: 91,814,968 probably null Het
Slc18a1 T A 8: 69,040,981 I400L probably benign Het
Slc30a3 A G 5: 31,089,614 S73P probably damaging Het
Slc9a5 A T 8: 105,363,968 N685I possibly damaging Het
Tnc C T 4: 63,965,604 R1868H probably benign Het
Trdmt1 A G 2: 13,516,013 probably null Het
Ttyh1 G T 7: 4,133,222 probably null Het
Tyms A T 5: 30,061,071 D283E probably benign Het
Vmn2r110 T A 17: 20,583,536 Y259F probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r88 C A 14: 51,413,969 Q255K probably benign Het
Vmn2r95 C T 17: 18,439,293 P100S probably damaging Het
Zfp128 A T 7: 12,890,899 H398L possibly damaging Het
Other mutations in 1700018F24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:1700018F24Rik APN 5 145043147 missense possibly damaging 0.83
IGL01751:1700018F24Rik APN 5 145043171 splice site probably null
IGL02928:1700018F24Rik APN 5 145043517 missense probably damaging 1.00
IGL03324:1700018F24Rik APN 5 145045451 missense probably benign 0.01
PIT4486001:1700018F24Rik UTSW 5 145044104 missense probably damaging 1.00
R0359:1700018F24Rik UTSW 5 145045371 nonsense probably null
R0554:1700018F24Rik UTSW 5 145045371 nonsense probably null
R0724:1700018F24Rik UTSW 5 145044763 missense probably benign 0.10
R1774:1700018F24Rik UTSW 5 145045541 missense probably damaging 0.99
R2041:1700018F24Rik UTSW 5 145045401 missense probably damaging 0.99
R4625:1700018F24Rik UTSW 5 145044883 missense possibly damaging 0.95
R5043:1700018F24Rik UTSW 5 145044100 nonsense probably null
R5610:1700018F24Rik UTSW 5 145045346 missense possibly damaging 0.92
R5712:1700018F24Rik UTSW 5 145044753 missense probably benign 0.32
R6163:1700018F24Rik UTSW 5 145045288 nonsense probably null
R7174:1700018F24Rik UTSW 5 145044817 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CATCAGCTTACAGGCTAACAGC -3'
(R):5'- GCTTCAGGCCAAATTCTGC -3'

Sequencing Primer
(F):5'- CTAACAGCCATTGTCTGATCTGATGG -3'
(R):5'- TTCTGCAGAATACACAGGAGGATCC -3'
Posted On2018-09-12