Mutagenetix > Incidental Mutations

Incidental Mutation 'R6799:Egfr'

533223

Institutional Source

Beutler Lab

Gene Symbol

Egfr

Ensembl Gene

ENSMUSG00000020122

Gene Name

epidermal growth factor receptor

Synonyms

avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.923) question?

Stock #

R6799 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

16752203-16918158 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 16896952 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 783 (C783Y)

Ref Sequence

ENSEMBL: ENSMUSP00000020329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020329]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020329
AA Change: C783Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: C783Y

Domain	Start	End	E-Value	Type
low complexity region	5	25	N/A	INTRINSIC
Pfam:Recep_L_domain	57	168	1.4e-32	PFAM
low complexity region	182	195	N/A	INTRINSIC
FU	228	270	6.07e-4	SMART
Pfam:Recep_L_domain	361	481	1.8e-29	PFAM
FU	496	547	8.25e-6	SMART
FU	552	601	4.38e-10	SMART
FU	614	654	4.05e1	SMART
low complexity region	677	694	N/A	INTRINSIC
TyrKc	714	970	2.88e-129	SMART
low complexity region	1004	1017	N/A	INTRINSIC
low complexity region	1027	1048	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	A	T	5: 145,044,814	Y153F	probably damaging	Het
5830473C10Rik	A	G	5: 90,579,615	H364R	probably damaging	Het
Abcb1b	T	A	5: 8,812,656	Y113N	probably damaging	Het
Anapc1	C	G	2: 128,659,737	R795T	probably null	Het
Arhgap18	T	A	10: 26,849,921	N47K	possibly damaging	Het
Arhgap26	A	G	18: 39,099,607	N96D	probably damaging	Het
Asxl3	G	T	18: 22,465,400	E191*	probably null	Het
Cc2d2b	A	G	19: 40,791,208	E697G	possibly damaging	Het
Chaf1a	A	T	17: 56,047,059	I110F	unknown	Het
Clca4b	A	T	3: 144,915,627		probably null	Het
Dagla	C	A	19: 10,256,850	V366L	probably damaging	Het
Dapk1	A	G	13: 60,752,235	N878S	probably benign	Het
Dapk3	A	G	10: 81,190,262	Y129C	probably damaging	Het
Dhx38	A	G	8: 109,553,202	L952P	probably damaging	Het
Drosha	T	A	15: 12,912,537	Y1080*	probably null	Het
Dscaml1	G	A	9: 45,450,583	V214I	probably benign	Het
Dtymk	A	G	1: 93,798,492	L15P	probably benign	Het
E330034G19Rik	A	G	14: 24,296,110	M30V	probably benign	Het
Epha8	C	T	4: 136,945,669	R268Q	probably benign	Het
Fbxw24	T	A	9: 109,624,930	R49S	probably damaging	Het
Fuk	T	C	8: 110,893,418	M276V	probably benign	Het
Gm8797	A	T	3: 5,750,967	T22S	probably benign	Het
Hao1	T	C	2: 134,530,765	S108G	probably damaging	Het
Hdac4	C	A	1: 92,002,213	A184S	probably damaging	Het
Hikeshi	T	A	7: 89,930,345		probably benign	Het
Hivep2	C	T	10: 14,129,013	R452C	probably benign	Het
Hsdl1	T	C	8: 119,566,430	S68G	probably benign	Het
Kctd20	T	C	17: 28,963,377		probably null	Het
Klf11	T	C	12: 24,655,639	V364A	possibly damaging	Het
Kpna6	A	G	4: 129,657,454	L86P	probably damaging	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lpin1	T	A	12: 16,561,044	N516Y	probably damaging	Het
Lrp2	T	C	2: 69,483,904	Y2161C	probably damaging	Het
Lrrtm3	A	T	10: 64,087,851	C512*	probably null	Het
Mfsd1	T	C	3: 67,599,981	I405T	probably damaging	Het
Msc	T	G	1: 14,755,267	D161A	probably damaging	Het
Mttp	T	C	3: 138,095,080	I755V	probably benign	Het
Ncam1	T	C	9: 49,508,611	T803A	probably damaging	Het
Nlrp14	A	G	7: 107,196,139	I210V	probably benign	Het
Npat	A	T	9: 53,551,630	H108L	probably benign	Het
Nt5dc1	A	G	10: 34,313,707	I329T	possibly damaging	Het
Olfr1417	T	A	19: 11,828,814	I71F	possibly damaging	Het
Olfr638	T	A	7: 103,998,799		probably null	Het
Olfr881	T	C	9: 37,993,182	L230P	possibly damaging	Het
Parm1	C	T	5: 91,594,211	T146I	possibly damaging	Het
Parp2	T	C	14: 50,821,096	Y528H	probably damaging	Het
Pias1	G	T	9: 62,882,052	S624R	probably benign	Het
Ppif	A	G	14: 25,696,064	H95R	probably damaging	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Psg20	A	G	7: 18,684,420	Y141H	probably benign	Het
Pygm	A	T	19: 6,398,127	Y733F	probably damaging	Het
Rcc1l	A	T	5: 134,176,713	M1K	probably null	Het
Rfpl4b	T	C	10: 38,821,345	K87E	possibly damaging	Het
Rnf113a1	A	C	X: 37,192,187	T266P	probably benign	Het
Scn5a	A	C	9: 119,495,622	I1380S	possibly damaging	Het
Sel1l	A	G	12: 91,814,968		probably null	Het
Slc18a1	T	A	8: 69,040,981	I400L	probably benign	Het
Slc30a3	A	G	5: 31,089,614	S73P	probably damaging	Het
Slc9a5	A	T	8: 105,363,968	N685I	possibly damaging	Het
Tnc	C	T	4: 63,965,604	R1868H	probably benign	Het
Trdmt1	A	G	2: 13,516,013		probably null	Het
Ttyh1	G	T	7: 4,133,222		probably null	Het
Tyms	A	T	5: 30,061,071	D283E	probably benign	Het
Vmn2r110	T	A	17: 20,583,536	Y259F	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r88	C	A	14: 51,413,969	Q255K	probably benign	Het
Vmn2r95	C	T	17: 18,439,293	P100S	probably damaging	Het
Zfp128	A	T	7: 12,890,899	H398L	possibly damaging	Het

Other mutations in Egfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Egfr	APN	11	16863020	missense	probably damaging	1.00
IGL01529:Egfr	APN	11	16863014	missense	probably benign
IGL01556:Egfr	APN	11	16905382	missense	probably damaging	1.00
IGL02627:Egfr	APN	11	16869346	missense	probably damaging	1.00
IGL02862:Egfr	APN	11	16883562	missense	probably benign	0.25
IGL02945:Egfr	APN	11	16752514	missense	probably damaging	1.00
IGL02994:Egfr	APN	11	16911811	missense	probably damaging	1.00
IGL03395:Egfr	APN	11	16910261	splice site	probably benign
set	UTSW	11	16871881	splice site	probably benign
Velvet	UTSW	11	16904399	missense	probably damaging	1.00
PIT1430001:Egfr	UTSW	11	16910214	missense	probably benign	0.00
R0196:Egfr	UTSW	11	16911746	missense	probably benign	0.02
R0513:Egfr	UTSW	11	16872855	missense	probably damaging	1.00
R0567:Egfr	UTSW	11	16872873	missense	probably benign	0.01
R0629:Egfr	UTSW	11	16869333	missense	probably damaging	1.00
R0961:Egfr	UTSW	11	16862964	missense	probably damaging	1.00
R1163:Egfr	UTSW	11	16883546	missense	probably benign	0.02
R1454:Egfr	UTSW	11	16889920	missense	probably benign
R1456:Egfr	UTSW	11	16863065	missense	probably benign	0.00
R1503:Egfr	UTSW	11	16869301	missense	possibly damaging	0.86
R1577:Egfr	UTSW	11	16869241	missense	probably benign	0.04
R1595:Egfr	UTSW	11	16906847	missense	probably damaging	0.99
R1699:Egfr	UTSW	11	16859019	missense	probably benign	0.14
R2172:Egfr	UTSW	11	16911562	missense	probably benign	0.00
R3690:Egfr	UTSW	11	16871881	splice site	probably benign
R3922:Egfr	UTSW	11	16881495	missense	probably damaging	1.00
R4444:Egfr	UTSW	11	16871027	missense	probably benign	0.00
R4685:Egfr	UTSW	11	16858980	missense	probably damaging	1.00
R4737:Egfr	UTSW	11	16869231	missense	probably damaging	0.99
R4814:Egfr	UTSW	11	16869354	missense	probably damaging	1.00
R4841:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4842:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4903:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4964:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4985:Egfr	UTSW	11	16859029	nonsense	probably null
R4998:Egfr	UTSW	11	16881493	missense	possibly damaging	0.58
R5001:Egfr	UTSW	11	16904434	missense	probably damaging	0.98
R5304:Egfr	UTSW	11	16884260	missense	probably benign
R5309:Egfr	UTSW	11	16911703	missense	probably benign	0.00
R5653:Egfr	UTSW	11	16911617	missense	probably benign	0.04
R5905:Egfr	UTSW	11	16911494	missense	probably damaging	1.00
R6051:Egfr	UTSW	11	16883607	missense	possibly damaging	0.87
R6052:Egfr	UTSW	11	16911554	missense	probably benign	0.16
R6114:Egfr	UTSW	11	16904374	missense	possibly damaging	0.46
R6261:Egfr	UTSW	11	16889964	missense	probably benign	0.11
R6434:Egfr	UTSW	11	16869294	missense	probably benign	0.25
R6475:Egfr	UTSW	11	16891259	missense	probably benign
R7143:Egfr	UTSW	11	16871627	missense	probably benign	0.20
R7195:Egfr	UTSW	11	16868162	missense	probably damaging	1.00
R7459:Egfr	UTSW	11	16896967	missense	probably damaging	1.00
R7612:Egfr	UTSW	11	16859025	missense	possibly damaging	0.74
R7757:Egfr	UTSW	11	16889966	missense	possibly damaging	0.64
R7763:Egfr	UTSW	11	16891266	missense	probably damaging	1.00
R8315:Egfr	UTSW	11	16875027	missense	probably benign	0.08
R8320:Egfr	UTSW	11	16891251	missense	probably damaging	1.00
R8324:Egfr	UTSW	11	16858971	missense	probably damaging	0.99
R8324:Egfr	UTSW	11	16908885	missense	probably damaging	0.98
R8347:Egfr	UTSW	11	16878174	missense	probably damaging	1.00
R8440:Egfr	UTSW	11	16909831	missense	probably damaging	1.00
R8511:Egfr	UTSW	11	16896949	missense	probably damaging	1.00
Z1177:Egfr	UTSW	11	16862954	missense	probably benign	0.05
Z1177:Egfr	UTSW	11	16869319	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTTGCATAACCTGACACTTG -3'
(R):5'- CTGCTTCTGAGACCTGTCATTG -3'

Sequencing Primer
(F):5'- CCAGCCAGGAAACAATTG -3'
(R):5'- AGACCTGTCATTGAATCTTTGGGTAC -3'

Posted On

2018-09-12