Mutagenetix > Incidental Mutation

Incidental Mutation 'R6799:Vmn2r111'

533235

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R6799 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22559051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 549 (N549S)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	A	T	5: 145,044,814	Y153F	probably damaging	Het
5830473C10Rik	A	G	5: 90,579,615	H364R	probably damaging	Het
Abcb1b	T	A	5: 8,812,656	Y113N	probably damaging	Het
Anapc1	C	G	2: 128,659,737	R795T	probably null	Het
Arhgap18	T	A	10: 26,849,921	N47K	possibly damaging	Het
Arhgap26	A	G	18: 39,099,607	N96D	probably damaging	Het
Asxl3	G	T	18: 22,465,400	E191*	probably null	Het
Cc2d2b	A	G	19: 40,791,208	E697G	possibly damaging	Het
Chaf1a	A	T	17: 56,047,059	I110F	unknown	Het
Clca4b	A	T	3: 144,915,627		probably null	Het
Dagla	C	A	19: 10,256,850	V366L	probably damaging	Het
Dapk1	A	G	13: 60,752,235	N878S	probably benign	Het
Dapk3	A	G	10: 81,190,262	Y129C	probably damaging	Het
Dhx38	A	G	8: 109,553,202	L952P	probably damaging	Het
Drosha	T	A	15: 12,912,537	Y1080*	probably null	Het
Dscaml1	G	A	9: 45,450,583	V214I	probably benign	Het
Dtymk	A	G	1: 93,798,492	L15P	probably benign	Het
E330034G19Rik	A	G	14: 24,296,110	M30V	probably benign	Het
Egfr	G	A	11: 16,896,952	C783Y	probably damaging	Het
Epha8	C	T	4: 136,945,669	R268Q	probably benign	Het
Fbxw24	T	A	9: 109,624,930	R49S	probably damaging	Het
Fuk	T	C	8: 110,893,418	M276V	probably benign	Het
Gm8797	A	T	3: 5,750,967	T22S	probably benign	Het
Hao1	T	C	2: 134,530,765	S108G	probably damaging	Het
Hdac4	C	A	1: 92,002,213	A184S	probably damaging	Het
Hikeshi	T	A	7: 89,930,345		probably benign	Het
Hivep2	C	T	10: 14,129,013	R452C	probably benign	Het
Hsdl1	T	C	8: 119,566,430	S68G	probably benign	Het
Kctd20	T	C	17: 28,963,377		probably null	Het
Klf11	T	C	12: 24,655,639	V364A	possibly damaging	Het
Kpna6	A	G	4: 129,657,454	L86P	probably damaging	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lpin1	T	A	12: 16,561,044	N516Y	probably damaging	Het
Lrp2	T	C	2: 69,483,904	Y2161C	probably damaging	Het
Lrrtm3	A	T	10: 64,087,851	C512*	probably null	Het
Mfsd1	T	C	3: 67,599,981	I405T	probably damaging	Het
Msc	T	G	1: 14,755,267	D161A	probably damaging	Het
Mttp	T	C	3: 138,095,080	I755V	probably benign	Het
Ncam1	T	C	9: 49,508,611	T803A	probably damaging	Het
Nlrp14	A	G	7: 107,196,139	I210V	probably benign	Het
Npat	A	T	9: 53,551,630	H108L	probably benign	Het
Nt5dc1	A	G	10: 34,313,707	I329T	possibly damaging	Het
Olfr1417	T	A	19: 11,828,814	I71F	possibly damaging	Het
Olfr638	T	A	7: 103,998,799		probably null	Het
Olfr881	T	C	9: 37,993,182	L230P	possibly damaging	Het
Parm1	C	T	5: 91,594,211	T146I	possibly damaging	Het
Parp2	T	C	14: 50,821,096	Y528H	probably damaging	Het
Pias1	G	T	9: 62,882,052	S624R	probably benign	Het
Ppif	A	G	14: 25,696,064	H95R	probably damaging	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Psg20	A	G	7: 18,684,420	Y141H	probably benign	Het
Pygm	A	T	19: 6,398,127	Y733F	probably damaging	Het
Rcc1l	A	T	5: 134,176,713	M1K	probably null	Het
Rfpl4b	T	C	10: 38,821,345	K87E	possibly damaging	Het
Rnf113a1	A	C	X: 37,192,187	T266P	probably benign	Het
Scn5a	A	C	9: 119,495,622	I1380S	possibly damaging	Het
Sel1l	A	G	12: 91,814,968		probably null	Het
Slc18a1	T	A	8: 69,040,981	I400L	probably benign	Het
Slc30a3	A	G	5: 31,089,614	S73P	probably damaging	Het
Slc9a5	A	T	8: 105,363,968	N685I	possibly damaging	Het
Tnc	C	T	4: 63,965,604	R1868H	probably benign	Het
Trdmt1	A	G	2: 13,516,013		probably null	Het
Ttyh1	G	T	7: 4,133,222		probably null	Het
Tyms	A	T	5: 30,061,071	D283E	probably benign	Het
Vmn2r110	T	A	17: 20,583,536	Y259F	probably benign	Het
Vmn2r88	C	A	14: 51,413,969	Q255K	probably benign	Het
Vmn2r95	C	T	17: 18,439,293	P100S	probably damaging	Het
Zfp128	A	T	7: 12,890,899	H398L	possibly damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCAAGGTGTAAAAGATGCAGCCC -3'
(R):5'- TCAAGGAGTTGGGAAACAATTCAAC -3'

Sequencing Primer
(F):5'- GGTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'

Posted On

2018-09-12