Incidental Mutation 'R6799:Pygm'
ID533240
Institutional Source Beutler Lab
Gene Symbol Pygm
Ensembl Gene ENSMUSG00000032648
Gene Namemuscle glycogen phosphorylase
SynonymsPG
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6799 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location6384399-6398459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6398127 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 733 (Y733F)
Ref Sequence ENSEMBL: ENSMUSP00000109111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035269] [ENSMUST00000035716] [ENSMUST00000113467] [ENSMUST00000113468] [ENSMUST00000113469] [ENSMUST00000113471] [ENSMUST00000113472] [ENSMUST00000113475] [ENSMUST00000113476] [ENSMUST00000113483] [ENSMUST00000127021] [ENSMUST00000138555] [ENSMUST00000139522] [ENSMUST00000146601] [ENSMUST00000146831] [ENSMUST00000150713] [ENSMUST00000167240]
Predicted Effect probably damaging
Transcript: ENSMUST00000035269
AA Change: Y821F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047564
Gene: ENSMUSG00000032648
AA Change: Y821F

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035716
SMART Domains Protein: ENSMUSP00000041135
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113467
SMART Domains Protein: ENSMUSP00000109095
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113468
SMART Domains Protein: ENSMUSP00000109096
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 97 1.93e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113469
SMART Domains Protein: ENSMUSP00000109097
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113471
SMART Domains Protein: ENSMUSP00000109099
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113472
SMART Domains Protein: ENSMUSP00000109100
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113475
SMART Domains Protein: ENSMUSP00000109103
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113476
SMART Domains Protein: ENSMUSP00000109104
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113483
AA Change: Y733F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109111
Gene: ENSMUSG00000032648
AA Change: Y733F

DomainStartEndE-ValueType
Pfam:Phosphorylase 62 742 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127021
SMART Domains Protein: ENSMUSP00000119740
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138555
SMART Domains Protein: ENSMUSP00000121635
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
Pfam:RasGEF 151 231 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139522
SMART Domains Protein: ENSMUSP00000123036
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 125 6.02e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146601
SMART Domains Protein: ENSMUSP00000117681
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 58 1e-35 BLAST
SCOP:d1bkds_ 9 58 1e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146831
SMART Domains Protein: ENSMUSP00000120630
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150713
SMART Domains Protein: ENSMUSP00000120949
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 95 6.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167240
SMART Domains Protein: ENSMUSP00000129873
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycolysis enzyme found in muscle. Highly similar enzymes encoded by different genes are found in liver and brain. The encoded protein is involved in regulating the breakdown of glycogen to glucose-1-phosphate, which is necessary for ATP generation. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation exhibit massive muscle glycogen accumulation, elevated creatine kinase levels in blood, and very poor exercise performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A T 5: 145,044,814 Y153F probably damaging Het
5830473C10Rik A G 5: 90,579,615 H364R probably damaging Het
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Anapc1 C G 2: 128,659,737 R795T probably null Het
Arhgap18 T A 10: 26,849,921 N47K possibly damaging Het
Arhgap26 A G 18: 39,099,607 N96D probably damaging Het
Asxl3 G T 18: 22,465,400 E191* probably null Het
Cc2d2b A G 19: 40,791,208 E697G possibly damaging Het
Chaf1a A T 17: 56,047,059 I110F unknown Het
Clca4b A T 3: 144,915,627 probably null Het
Dagla C A 19: 10,256,850 V366L probably damaging Het
Dapk1 A G 13: 60,752,235 N878S probably benign Het
Dapk3 A G 10: 81,190,262 Y129C probably damaging Het
Dhx38 A G 8: 109,553,202 L952P probably damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dscaml1 G A 9: 45,450,583 V214I probably benign Het
Dtymk A G 1: 93,798,492 L15P probably benign Het
E330034G19Rik A G 14: 24,296,110 M30V probably benign Het
Egfr G A 11: 16,896,952 C783Y probably damaging Het
Epha8 C T 4: 136,945,669 R268Q probably benign Het
Fbxw24 T A 9: 109,624,930 R49S probably damaging Het
Fuk T C 8: 110,893,418 M276V probably benign Het
Gm8797 A T 3: 5,750,967 T22S probably benign Het
Hao1 T C 2: 134,530,765 S108G probably damaging Het
Hdac4 C A 1: 92,002,213 A184S probably damaging Het
Hikeshi T A 7: 89,930,345 probably benign Het
Hivep2 C T 10: 14,129,013 R452C probably benign Het
Hsdl1 T C 8: 119,566,430 S68G probably benign Het
Kctd20 T C 17: 28,963,377 probably null Het
Klf11 T C 12: 24,655,639 V364A possibly damaging Het
Kpna6 A G 4: 129,657,454 L86P probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lpin1 T A 12: 16,561,044 N516Y probably damaging Het
Lrp2 T C 2: 69,483,904 Y2161C probably damaging Het
Lrrtm3 A T 10: 64,087,851 C512* probably null Het
Mfsd1 T C 3: 67,599,981 I405T probably damaging Het
Msc T G 1: 14,755,267 D161A probably damaging Het
Mttp T C 3: 138,095,080 I755V probably benign Het
Ncam1 T C 9: 49,508,611 T803A probably damaging Het
Nlrp14 A G 7: 107,196,139 I210V probably benign Het
Npat A T 9: 53,551,630 H108L probably benign Het
Nt5dc1 A G 10: 34,313,707 I329T possibly damaging Het
Olfr1417 T A 19: 11,828,814 I71F possibly damaging Het
Olfr638 T A 7: 103,998,799 probably null Het
Olfr881 T C 9: 37,993,182 L230P possibly damaging Het
Parm1 C T 5: 91,594,211 T146I possibly damaging Het
Parp2 T C 14: 50,821,096 Y528H probably damaging Het
Pias1 G T 9: 62,882,052 S624R probably benign Het
Ppif A G 14: 25,696,064 H95R probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Psg20 A G 7: 18,684,420 Y141H probably benign Het
Rcc1l A T 5: 134,176,713 M1K probably null Het
Rfpl4b T C 10: 38,821,345 K87E possibly damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Scn5a A C 9: 119,495,622 I1380S possibly damaging Het
Sel1l A G 12: 91,814,968 probably null Het
Slc18a1 T A 8: 69,040,981 I400L probably benign Het
Slc30a3 A G 5: 31,089,614 S73P probably damaging Het
Slc9a5 A T 8: 105,363,968 N685I possibly damaging Het
Tnc C T 4: 63,965,604 R1868H probably benign Het
Trdmt1 A G 2: 13,516,013 probably null Het
Ttyh1 G T 7: 4,133,222 probably null Het
Tyms A T 5: 30,061,071 D283E probably benign Het
Vmn2r110 T A 17: 20,583,536 Y259F probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r88 C A 14: 51,413,969 Q255K probably benign Het
Vmn2r95 C T 17: 18,439,293 P100S probably damaging Het
Zfp128 A T 7: 12,890,899 H398L possibly damaging Het
Other mutations in Pygm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Pygm APN 19 6391394 missense probably benign
IGL01743:Pygm APN 19 6392994 splice site probably null
IGL01827:Pygm APN 19 6390377 missense probably damaging 1.00
IGL02032:Pygm APN 19 6388087 missense probably benign 0.23
IGL02261:Pygm APN 19 6388271 missense probably damaging 1.00
IGL02431:Pygm APN 19 6388118 missense probably damaging 1.00
IGL02511:Pygm APN 19 6385688 missense probably benign 0.22
IGL02967:Pygm APN 19 6393838 missense probably damaging 1.00
IGL03081:Pygm APN 19 6388821 missense possibly damaging 0.53
R0336:Pygm UTSW 19 6388758 missense probably damaging 1.00
R0415:Pygm UTSW 19 6391366 missense probably benign 0.06
R0799:Pygm UTSW 19 6386018 intron probably benign
R1445:Pygm UTSW 19 6389887 missense probably benign 0.20
R1752:Pygm UTSW 19 6391034 missense probably damaging 0.99
R1828:Pygm UTSW 19 6397607 missense possibly damaging 0.72
R2054:Pygm UTSW 19 6388155 missense probably benign 0.02
R2086:Pygm UTSW 19 6391481 critical splice donor site probably null
R2116:Pygm UTSW 19 6386408 missense probably damaging 0.98
R2431:Pygm UTSW 19 6393785 missense probably damaging 1.00
R2516:Pygm UTSW 19 6397601 missense probably benign 0.20
R3938:Pygm UTSW 19 6392950 missense probably benign 0.42
R4609:Pygm UTSW 19 6391409 missense possibly damaging 0.92
R4924:Pygm UTSW 19 6393724 missense probably damaging 1.00
R4995:Pygm UTSW 19 6398139 missense probably damaging 1.00
R5225:Pygm UTSW 19 6389464 missense probably benign 0.01
R5296:Pygm UTSW 19 6384579 missense probably damaging 1.00
R5437:Pygm UTSW 19 6390382 missense probably damaging 1.00
R5994:Pygm UTSW 19 6398043 critical splice acceptor site probably null
R6030:Pygm UTSW 19 6388812 missense possibly damaging 0.78
R6030:Pygm UTSW 19 6388812 missense possibly damaging 0.78
R6188:Pygm UTSW 19 6397937 splice site probably null
R6266:Pygm UTSW 19 6398139 missense probably damaging 1.00
R6855:Pygm UTSW 19 6393757 missense probably damaging 1.00
R6856:Pygm UTSW 19 6393757 missense probably damaging 1.00
R6857:Pygm UTSW 19 6393757 missense probably damaging 1.00
R7223:Pygm UTSW 19 6388863 missense probably benign
R7256:Pygm UTSW 19 6385896 missense probably benign 0.01
R7263:Pygm UTSW 19 6388327 missense probably damaging 1.00
R7398:Pygm UTSW 19 6385936 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTACAAGGTGAGGGGTCC -3'
(R):5'- TCACACTAGGCATCAGGACCTAG -3'

Sequencing Primer
(F):5'- GTGAGGGGTCCAGCGGC -3'
(R):5'- CTAGGCATCAGGACCTAGAGACTG -3'
Posted On2018-09-12