Incidental Mutation 'R6800:Gigyf2'
ID533246
Institutional Source Beutler Lab
Gene Symbol Gigyf2
Ensembl Gene ENSMUSG00000048000
Gene NameGRB10 interacting GYF protein 2
Synonyms2610016F01Rik, Tnrc15, A830080H02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R6800 (G1)
Quality Score183.009
Status Validated
Chromosome1
Chromosomal Location87326998-87450796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87419176 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 576 (I576T)
Ref Sequence ENSEMBL: ENSMUSP00000129046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027475] [ENSMUST00000164992] [ENSMUST00000172794] [ENSMUST00000172964] [ENSMUST00000173173] [ENSMUST00000174501]
Predicted Effect unknown
Transcript: ENSMUST00000027475
AA Change: I633T
SMART Domains Protein: ENSMUSP00000027475
Gene: ENSMUSG00000048000
AA Change: I633T

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 2.48e-5 PROSPERO
internal_repeat_1 404 440 2.48e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
coiled coil region 723 1037 N/A INTRINSIC
low complexity region 1096 1110 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
coiled coil region 1194 1223 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1254 1260 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164992
AA Change: I576T

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129046
Gene: ENSMUSG00000048000
AA Change: I576T

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 129 N/A INTRINSIC
low complexity region 190 228 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
GYF 478 533 2.83e-26 SMART
low complexity region 563 610 N/A INTRINSIC
coiled coil region 666 721 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172794
AA Change: I627T
SMART Domains Protein: ENSMUSP00000134077
Gene: ENSMUSG00000048000
AA Change: I627T

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 241 279 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
internal_repeat_1 338 378 2.29e-5 PROSPERO
internal_repeat_1 398 434 2.29e-5 PROSPERO
GYF 529 584 2.83e-26 SMART
low complexity region 614 661 N/A INTRINSIC
coiled coil region 717 1031 N/A INTRINSIC
low complexity region 1090 1104 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
coiled coil region 1188 1217 N/A INTRINSIC
low complexity region 1230 1240 N/A INTRINSIC
low complexity region 1248 1254 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172964
AA Change: I633T
SMART Domains Protein: ENSMUSP00000133392
Gene: ENSMUSG00000048000
AA Change: I633T

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 3.03e-5 PROSPERO
internal_repeat_1 404 440 3.03e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
SCOP:d1eq1a_ 724 859 1e-2 SMART
low complexity region 953 972 N/A INTRINSIC
low complexity region 1008 1031 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173173
AA Change: I626T

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134193
Gene: ENSMUSG00000048000
AA Change: I626T

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 241 279 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
GYF 528 583 2.83e-26 SMART
low complexity region 613 660 N/A INTRINSIC
SCOP:d1eq1a_ 717 852 1e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000173235
AA Change: I454T
SMART Domains Protein: ENSMUSP00000134677
Gene: ENSMUSG00000048000
AA Change: I454T

DomainStartEndE-ValueType
low complexity region 69 107 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
internal_repeat_1 166 206 3.2e-5 PROSPERO
internal_repeat_1 226 262 3.2e-5 PROSPERO
GYF 357 412 2.83e-26 SMART
low complexity region 442 489 N/A INTRINSIC
coiled coil region 544 745 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000173636
Predicted Effect unknown
Transcript: ENSMUST00000174501
AA Change: I633T
SMART Domains Protein: ENSMUSP00000133327
Gene: ENSMUSG00000048000
AA Change: I633T

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 2.48e-5 PROSPERO
internal_repeat_1 404 440 2.48e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
coiled coil region 723 1037 N/A INTRINSIC
low complexity region 1096 1110 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
coiled coil region 1194 1223 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1254 1260 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains CAG trinucleotide repeats and encodes a protein containing several stretches of polyglutamine residues. The encoded protein may be involved in the regulation of tyrosine kinase receptor signaling. This gene is located in a chromosomal region that was genetically linked to Parkinson disease type 11, and mutations in this gene were thought to be causative for this disease. However, more recent studies in different populations have been unable to replicate this association. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal and postnatal lethality. Mice heterozygous for a knock-out allele exhibit impaired motor coordination with motor neuron degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,288,279 F2091S probably benign Het
4930486L24Rik G A 13: 60,845,134 P244S probably damaging Het
9130023H24Rik C A 7: 128,237,570 probably benign Het
Acoxl A T 2: 128,010,165 Q129L probably damaging Het
Akna T C 4: 63,398,031 T32A probably benign Het
Alox15 C T 11: 70,344,819 probably null Het
Antxrl T C 14: 34,065,907 S296P probably damaging Het
Arrb2 G T 11: 70,437,316 G52* probably null Het
BC067074 T A 13: 113,368,152 D396E probably benign Het
Capn2 A T 1: 182,481,480 I499N probably damaging Het
Cubn T A 2: 13,321,255 I2700F probably damaging Het
Cypt4 A T 9: 24,625,669 N152Y probably benign Het
Dmxl2 T C 9: 54,409,183 N1640D probably damaging Het
Dnah7b A T 1: 46,340,217 N3704Y possibly damaging Het
Dnah9 A G 11: 66,072,739 probably null Het
Elac2 G A 11: 64,999,439 probably null Het
Erich3 A T 3: 154,727,392 probably null Het
Espnl T C 1: 91,342,629 V386A probably damaging Het
Fbxl6 T A 15: 76,538,698 probably benign Het
Fdps A C 3: 89,100,761 F17V probably damaging Het
Gm20939 A G 17: 94,877,229 E435G possibly damaging Het
Gm4788 T A 1: 139,701,981 D683V possibly damaging Het
Hivep1 G A 13: 42,157,376 V1031I probably damaging Het
Hydin T G 8: 110,597,971 S4655A probably benign Het
Ifrd1 T A 12: 40,223,158 probably benign Het
Iqgap1 G T 7: 80,728,981 T1219K possibly damaging Het
Lmtk3 G A 7: 45,793,809 E639K possibly damaging Het
Map3k5 A G 10: 20,141,580 *1373W probably null Het
Mia2 G A 12: 59,188,546 probably null Het
Micu2 T C 14: 57,919,439 D313G possibly damaging Het
Mrgpra4 A G 7: 47,981,623 S77P probably damaging Het
Mrpl51 T C 6: 125,192,404 V17A probably benign Het
Neurod4 A T 10: 130,270,792 Y204* probably null Het
Olfr134 A G 17: 38,175,122 I13V probably benign Het
Olfr492 G A 7: 108,323,253 T141I probably benign Het
Olfr682-ps1 A T 7: 105,127,010 V97E probably benign Het
Olfr792 A T 10: 129,541,263 H242L probably damaging Het
Pate2 T C 9: 35,685,645 probably benign Het
Pcdhgb8 G A 18: 37,763,527 R550Q probably benign Het
Phldb3 T C 7: 24,624,152 L437P possibly damaging Het
Pianp C A 6: 125,001,602 P257T possibly damaging Het
Rbbp6 T A 7: 122,985,064 H140Q possibly damaging Het
Rfx2 A G 17: 56,780,804 I529T probably damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Rp1l1 T C 14: 64,031,150 I1395T possibly damaging Het
Rps6ka2 A C 17: 7,251,636 K186Q probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Rtel1 C A 2: 181,322,463 T85N probably benign Het
Rtn4rl2 T C 2: 84,880,623 N99S probably damaging Het
Ryr1 C T 7: 29,024,316 G4106D possibly damaging Het
Scgb2b24 A G 7: 33,738,469 V71A probably benign Het
Sgip1 A G 4: 102,921,028 probably benign Het
Slc12a4 G A 8: 105,949,739 T515I probably damaging Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Strbp C T 2: 37,625,216 R266Q probably damaging Het
Strn G T 17: 78,670,358 probably benign Het
Thnsl2 C A 6: 71,141,280 V55L probably benign Het
Tmem178b A T 6: 40,254,924 Q164L unknown Het
Tmprss6 C T 15: 78,440,257 R786H probably damaging Het
Ttc21a T A 9: 119,941,202 L113Q possibly damaging Het
Ttc21b T C 2: 66,208,650 probably null Het
Vmn2r51 T C 7: 10,098,264 D465G probably damaging Het
Vmp1 A C 11: 86,666,087 probably null Het
Wdcp T C 12: 4,851,358 F405L probably damaging Het
Zfhx3 A T 8: 108,949,517 T2400S probably benign Het
Zfp27 T C 7: 29,894,435 T702A probably benign Het
Zfp72 T C 13: 74,371,961 S333G probably benign Het
Other mutations in Gigyf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Gigyf2 APN 1 87436850 missense probably damaging 0.99
IGL01828:Gigyf2 APN 1 87419098 missense probably damaging 1.00
IGL02222:Gigyf2 APN 1 87410863 splice site probably null
IGL02259:Gigyf2 APN 1 87411837 missense probably damaging 1.00
IGL02562:Gigyf2 APN 1 87407375 missense probably benign 0.15
IGL02565:Gigyf2 APN 1 87442136 missense probably damaging 1.00
IGL02695:Gigyf2 APN 1 87416827 missense probably benign 0.07
IGL03264:Gigyf2 APN 1 87449068 splice site probably benign
Flop UTSW 1 87365266 missense probably damaging 1.00
FR4449:Gigyf2 UTSW 1 87428585 unclassified probably benign
PIT4260001:Gigyf2 UTSW 1 87419106 missense unknown
R0041:Gigyf2 UTSW 1 87378976 missense probably damaging 1.00
R0126:Gigyf2 UTSW 1 87411875 splice site probably benign
R0190:Gigyf2 UTSW 1 87428688 unclassified probably benign
R0244:Gigyf2 UTSW 1 87379015 missense possibly damaging 0.96
R0492:Gigyf2 UTSW 1 87440846 missense probably damaging 1.00
R0526:Gigyf2 UTSW 1 87421493 missense probably benign 0.00
R0612:Gigyf2 UTSW 1 87449080 missense probably damaging 1.00
R0731:Gigyf2 UTSW 1 87407727 splice site probably benign
R0783:Gigyf2 UTSW 1 87407161 missense probably damaging 0.99
R1445:Gigyf2 UTSW 1 87443638 splice site probably benign
R1620:Gigyf2 UTSW 1 87449128 missense probably damaging 1.00
R1678:Gigyf2 UTSW 1 87416983 missense probably benign 0.44
R2008:Gigyf2 UTSW 1 87374113 critical splice donor site probably null
R2111:Gigyf2 UTSW 1 87440730 missense probably damaging 0.99
R2112:Gigyf2 UTSW 1 87440730 missense probably damaging 0.99
R2180:Gigyf2 UTSW 1 87416920 missense probably damaging 1.00
R3438:Gigyf2 UTSW 1 87440580 missense probably damaging 0.96
R3690:Gigyf2 UTSW 1 87421516 missense possibly damaging 0.80
R4089:Gigyf2 UTSW 1 87443672 missense probably damaging 1.00
R4411:Gigyf2 UTSW 1 87436860 missense probably damaging 1.00
R4412:Gigyf2 UTSW 1 87436860 missense probably damaging 1.00
R4489:Gigyf2 UTSW 1 87440826 missense probably damaging 1.00
R4743:Gigyf2 UTSW 1 87365248 nonsense probably null
R4769:Gigyf2 UTSW 1 87440849 missense probably damaging 1.00
R4854:Gigyf2 UTSW 1 87354413 unclassified probably benign
R5215:Gigyf2 UTSW 1 87365266 missense probably damaging 1.00
R5326:Gigyf2 UTSW 1 87425138 unclassified probably benign
R5771:Gigyf2 UTSW 1 87446328 missense possibly damaging 0.90
R5813:Gigyf2 UTSW 1 87440763 missense probably damaging 0.99
R5964:Gigyf2 UTSW 1 87407167 missense probably damaging 1.00
R6026:Gigyf2 UTSW 1 87440732 missense probably damaging 0.99
R6035:Gigyf2 UTSW 1 87410728 missense possibly damaging 0.93
R6035:Gigyf2 UTSW 1 87410728 missense possibly damaging 0.93
R6784:Gigyf2 UTSW 1 87443674 missense probably damaging 1.00
R6991:Gigyf2 UTSW 1 87407136 missense probably damaging 1.00
R7224:Gigyf2 UTSW 1 87403725 missense unknown
R7464:Gigyf2 UTSW 1 87428604 missense unknown
R7554:Gigyf2 UTSW 1 87407570 missense unknown
R7658:Gigyf2 UTSW 1 87419138 missense unknown
R7976:Gigyf2 UTSW 1 87403736 missense unknown
R8032:Gigyf2 UTSW 1 87407013 missense unknown
R8070:Gigyf2 UTSW 1 87440907 missense probably benign 0.03
R8071:Gigyf2 UTSW 1 87446433 missense probably damaging 0.99
X0065:Gigyf2 UTSW 1 87411867 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGAAGGGCACAAGTTTGGAG -3'
(R):5'- GACCCTGAAAACCTAATTAGATGCC -3'

Sequencing Primer
(F):5'- TTTGGAGTAGGAAGCAAAGGTCTTG -3'
(R):5'- AAACCTAATTAGATGCCATTCTCTG -3'
Posted On2018-09-12