Incidental Mutation 'R6800:Espnl'
List |< first << previous [record 18 of 68] next >> last >|
ID533247
Institutional Source Beutler Lab
Gene Symbol Espnl
Ensembl Gene ENSMUSG00000049515
Gene Nameespin-like
SynonymsLOC227357
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6800 (G1)
Quality Score139.008
Status Validated
Chromosome1
Chromosomal Location91322075-91348306 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91342629 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 386 (V386A)
Ref Sequence ENSEMBL: ENSMUSP00000135828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088904] [ENSMUST00000176156]
Predicted Effect probably damaging
Transcript: ENSMUST00000088904
AA Change: V430A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086294
Gene: ENSMUSG00000049515
AA Change: V430A

DomainStartEndE-ValueType
Blast:ANK 1 33 4e-7 BLAST
ANK 35 64 5.21e1 SMART
ANK 69 102 2.88e2 SMART
ANK 103 132 3.85e-2 SMART
ANK 136 166 7.08e-1 SMART
ANK 170 200 1.02e-1 SMART
ANK 204 232 3.04e0 SMART
ANK 238 267 5.01e-1 SMART
ANK 270 299 1.96e-3 SMART
ANK 303 332 3.21e1 SMART
low complexity region 336 345 N/A INTRINSIC
coiled coil region 509 538 N/A INTRINSIC
low complexity region 820 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176156
AA Change: V386A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135828
Gene: ENSMUSG00000049515
AA Change: V386A

DomainStartEndE-ValueType
Blast:ANK 1 33 5e-7 BLAST
ANK 35 64 5.21e1 SMART
ANK 69 102 2.88e2 SMART
ANK 103 132 3.85e-2 SMART
ANK 136 166 7.08e-1 SMART
ANK 170 200 1.02e-1 SMART
ANK 204 232 3.04e0 SMART
ANK 238 267 5.01e-1 SMART
low complexity region 292 301 N/A INTRINSIC
coiled coil region 465 494 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,288,279 F2091S probably benign Het
4930486L24Rik G A 13: 60,845,134 P244S probably damaging Het
9130023H24Rik C A 7: 128,237,570 probably benign Het
Acoxl A T 2: 128,010,165 Q129L probably damaging Het
Akna T C 4: 63,398,031 T32A probably benign Het
Alox15 C T 11: 70,344,819 probably null Het
Antxrl T C 14: 34,065,907 S296P probably damaging Het
Arrb2 G T 11: 70,437,316 G52* probably null Het
BC067074 T A 13: 113,368,152 D396E probably benign Het
Capn2 A T 1: 182,481,480 I499N probably damaging Het
Cubn T A 2: 13,321,255 I2700F probably damaging Het
Cypt4 A T 9: 24,625,669 N152Y probably benign Het
Dmxl2 T C 9: 54,409,183 N1640D probably damaging Het
Dnah7b A T 1: 46,340,217 N3704Y possibly damaging Het
Dnah9 A G 11: 66,072,739 probably null Het
Elac2 G A 11: 64,999,439 probably null Het
Erich3 A T 3: 154,727,392 probably null Het
Fbxl6 T A 15: 76,538,698 probably benign Het
Fdps A C 3: 89,100,761 F17V probably damaging Het
Gigyf2 T C 1: 87,419,176 I576T possibly damaging Het
Gm20939 A G 17: 94,877,229 E435G possibly damaging Het
Gm4788 T A 1: 139,701,981 D683V possibly damaging Het
Hivep1 G A 13: 42,157,376 V1031I probably damaging Het
Hydin T G 8: 110,597,971 S4655A probably benign Het
Ifrd1 T A 12: 40,223,158 probably benign Het
Iqgap1 G T 7: 80,728,981 T1219K possibly damaging Het
Lmtk3 G A 7: 45,793,809 E639K possibly damaging Het
Map3k5 A G 10: 20,141,580 *1373W probably null Het
Mia2 G A 12: 59,188,546 probably null Het
Micu2 T C 14: 57,919,439 D313G possibly damaging Het
Mrgpra4 A G 7: 47,981,623 S77P probably damaging Het
Mrpl51 T C 6: 125,192,404 V17A probably benign Het
Neurod4 A T 10: 130,270,792 Y204* probably null Het
Olfr134 A G 17: 38,175,122 I13V probably benign Het
Olfr492 G A 7: 108,323,253 T141I probably benign Het
Olfr682-ps1 A T 7: 105,127,010 V97E probably benign Het
Olfr792 A T 10: 129,541,263 H242L probably damaging Het
Pate2 T C 9: 35,685,645 probably benign Het
Pcdhgb8 G A 18: 37,763,527 R550Q probably benign Het
Phldb3 T C 7: 24,624,152 L437P possibly damaging Het
Pianp C A 6: 125,001,602 P257T possibly damaging Het
Rbbp6 T A 7: 122,985,064 H140Q possibly damaging Het
Rfx2 A G 17: 56,780,804 I529T probably damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Rp1l1 T C 14: 64,031,150 I1395T possibly damaging Het
Rps6ka2 A C 17: 7,251,636 K186Q probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Rtel1 C A 2: 181,322,463 T85N probably benign Het
Rtn4rl2 T C 2: 84,880,623 N99S probably damaging Het
Ryr1 C T 7: 29,024,316 G4106D possibly damaging Het
Scgb2b24 A G 7: 33,738,469 V71A probably benign Het
Sgip1 A G 4: 102,921,028 probably benign Het
Slc12a4 G A 8: 105,949,739 T515I probably damaging Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Strbp C T 2: 37,625,216 R266Q probably damaging Het
Strn G T 17: 78,670,358 probably benign Het
Thnsl2 C A 6: 71,141,280 V55L probably benign Het
Tmem178b A T 6: 40,254,924 Q164L unknown Het
Tmprss6 C T 15: 78,440,257 R786H probably damaging Het
Ttc21a T A 9: 119,941,202 L113Q possibly damaging Het
Ttc21b T C 2: 66,208,650 probably null Het
Vmn2r51 T C 7: 10,098,264 D465G probably damaging Het
Vmp1 A C 11: 86,666,087 probably null Het
Wdcp T C 12: 4,851,358 F405L probably damaging Het
Zfhx3 A T 8: 108,949,517 T2400S probably benign Het
Zfp27 T C 7: 29,894,435 T702A probably benign Het
Zfp72 T C 13: 74,371,961 S333G probably benign Het
Other mutations in Espnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Espnl APN 1 91340611 nonsense probably null
IGL01726:Espnl APN 1 91344904 missense probably benign
IGL02402:Espnl APN 1 91344813 missense probably benign 0.13
IGL02472:Espnl APN 1 91340534 missense probably benign 0.02
IGL02986:Espnl APN 1 91344850 missense probably benign 0.01
IGL03037:Espnl APN 1 91341921 missense probably benign 0.01
IGL03073:Espnl APN 1 91344556 missense probably damaging 0.99
R0111:Espnl UTSW 1 91344742 missense probably benign 0.29
R0197:Espnl UTSW 1 91344489 missense probably damaging 1.00
R0238:Espnl UTSW 1 91322287 missense probably damaging 0.97
R0239:Espnl UTSW 1 91322287 missense probably damaging 0.97
R0239:Espnl UTSW 1 91322287 missense probably damaging 0.97
R0665:Espnl UTSW 1 91334687 splice site probably null
R1772:Espnl UTSW 1 91344603 missense possibly damaging 0.61
R3804:Espnl UTSW 1 91322221 missense probably benign 0.00
R4352:Espnl UTSW 1 91334721 missense probably damaging 1.00
R4566:Espnl UTSW 1 91344579 missense possibly damaging 0.46
R4790:Espnl UTSW 1 91344424 missense probably damaging 1.00
R5234:Espnl UTSW 1 91344793 missense probably benign 0.02
R6430:Espnl UTSW 1 91322248 missense possibly damaging 0.75
R6652:Espnl UTSW 1 91344699 missense probably benign 0.13
R6785:Espnl UTSW 1 91322221 missense probably benign 0.00
R7082:Espnl UTSW 1 91334799 missense probably benign 0.00
R7311:Espnl UTSW 1 91323568 missense probably damaging 0.98
R7376:Espnl UTSW 1 91322314 missense probably damaging 1.00
R7880:Espnl UTSW 1 91344766 missense possibly damaging 0.81
R8154:Espnl UTSW 1 91325199 missense possibly damaging 0.87
Z1177:Espnl UTSW 1 91323555 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCATCCAGTCGGCATAG -3'
(R):5'- TACTCAGTGGCCATGATCCC -3'

Sequencing Primer
(F):5'- CCTTAATTAGGCTAGGGACAGG -3'
(R):5'- GTGGCCATGATCCCACCTC -3'
Posted On2018-09-12