Incidental Mutation 'R6800:Gm4788'
ID533248
Institutional Source Beutler Lab
Gene Symbol Gm4788
Ensembl Gene ENSMUSG00000070594
Gene Namepredicted gene 4788
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6800 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location139697623-139781243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139701981 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 683 (D683V)
Ref Sequence ENSEMBL: ENSMUSP00000027612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027612] [ENSMUST00000111986] [ENSMUST00000111989]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027612
AA Change: D683V

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027612
Gene: ENSMUSG00000070594
AA Change: D683V

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 332 386 9.1e-14 SMART
CCP 393 446 1.58e-13 SMART
CCP 455 505 4.92e-1 SMART
CCP 511 564 8.9e-8 SMART
CCP 569 622 4.18e-13 SMART
CCP 627 681 3.5e-15 SMART
CCP 688 742 5.69e-15 SMART
CCP 746 807 2.77e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111986
AA Change: N695I

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107617
Gene: ENSMUSG00000070594
AA Change: N695I

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 333 387 9.1e-14 SMART
CCP 394 447 1.58e-13 SMART
CCP 456 506 4.92e-1 SMART
CCP 512 565 8.9e-8 SMART
CCP 571 635 2.66e-6 SMART
CCP 640 693 4.18e-13 SMART
CCP 700 754 5.69e-15 SMART
CCP 758 819 2.77e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111989
AA Change: D754V

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107620
Gene: ENSMUSG00000070594
AA Change: D754V

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 333 387 9.1e-14 SMART
CCP 394 447 1.58e-13 SMART
CCP 456 506 4.92e-1 SMART
CCP 512 565 8.9e-8 SMART
CCP 571 635 2.66e-6 SMART
CCP 640 693 4.18e-13 SMART
CCP 698 752 3.5e-15 SMART
CCP 759 813 5.69e-15 SMART
CCP 817 878 2.77e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,288,279 F2091S probably benign Het
4930486L24Rik G A 13: 60,845,134 P244S probably damaging Het
9130023H24Rik C A 7: 128,237,570 probably benign Het
Acoxl A T 2: 128,010,165 Q129L probably damaging Het
Akna T C 4: 63,398,031 T32A probably benign Het
Alox15 C T 11: 70,344,819 probably null Het
Antxrl T C 14: 34,065,907 S296P probably damaging Het
Arrb2 G T 11: 70,437,316 G52* probably null Het
BC067074 T A 13: 113,368,152 D396E probably benign Het
Capn2 A T 1: 182,481,480 I499N probably damaging Het
Cubn T A 2: 13,321,255 I2700F probably damaging Het
Cypt4 A T 9: 24,625,669 N152Y probably benign Het
Dmxl2 T C 9: 54,409,183 N1640D probably damaging Het
Dnah7b A T 1: 46,340,217 N3704Y possibly damaging Het
Dnah9 A G 11: 66,072,739 probably null Het
Elac2 G A 11: 64,999,439 probably null Het
Erich3 A T 3: 154,727,392 probably null Het
Espnl T C 1: 91,342,629 V386A probably damaging Het
Fbxl6 T A 15: 76,538,698 probably benign Het
Fdps A C 3: 89,100,761 F17V probably damaging Het
Gigyf2 T C 1: 87,419,176 I576T possibly damaging Het
Gm20939 A G 17: 94,877,229 E435G possibly damaging Het
Hivep1 G A 13: 42,157,376 V1031I probably damaging Het
Hydin T G 8: 110,597,971 S4655A probably benign Het
Ifrd1 T A 12: 40,223,158 probably benign Het
Iqgap1 G T 7: 80,728,981 T1219K possibly damaging Het
Lmtk3 G A 7: 45,793,809 E639K possibly damaging Het
Map3k5 A G 10: 20,141,580 *1373W probably null Het
Mia2 G A 12: 59,188,546 probably null Het
Micu2 T C 14: 57,919,439 D313G possibly damaging Het
Mrgpra4 A G 7: 47,981,623 S77P probably damaging Het
Mrpl51 T C 6: 125,192,404 V17A probably benign Het
Neurod4 A T 10: 130,270,792 Y204* probably null Het
Olfr134 A G 17: 38,175,122 I13V probably benign Het
Olfr492 G A 7: 108,323,253 T141I probably benign Het
Olfr682-ps1 A T 7: 105,127,010 V97E probably benign Het
Olfr792 A T 10: 129,541,263 H242L probably damaging Het
Pate2 T C 9: 35,685,645 probably benign Het
Pcdhgb8 G A 18: 37,763,527 R550Q probably benign Het
Phldb3 T C 7: 24,624,152 L437P possibly damaging Het
Pianp C A 6: 125,001,602 P257T possibly damaging Het
Rbbp6 T A 7: 122,985,064 H140Q possibly damaging Het
Rfx2 A G 17: 56,780,804 I529T probably damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Rp1l1 T C 14: 64,031,150 I1395T possibly damaging Het
Rps6ka2 A C 17: 7,251,636 K186Q probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Rtel1 C A 2: 181,322,463 T85N probably benign Het
Rtn4rl2 T C 2: 84,880,623 N99S probably damaging Het
Ryr1 C T 7: 29,024,316 G4106D possibly damaging Het
Scgb2b24 A G 7: 33,738,469 V71A probably benign Het
Sgip1 A G 4: 102,921,028 probably benign Het
Slc12a4 G A 8: 105,949,739 T515I probably damaging Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Strbp C T 2: 37,625,216 R266Q probably damaging Het
Strn G T 17: 78,670,358 probably benign Het
Thnsl2 C A 6: 71,141,280 V55L probably benign Het
Tmem178b A T 6: 40,254,924 Q164L unknown Het
Tmprss6 C T 15: 78,440,257 R786H probably damaging Het
Ttc21a T A 9: 119,941,202 L113Q possibly damaging Het
Ttc21b T C 2: 66,208,650 probably null Het
Vmn2r51 T C 7: 10,098,264 D465G probably damaging Het
Vmp1 A C 11: 86,666,087 probably null Het
Wdcp T C 12: 4,851,358 F405L probably damaging Het
Zfhx3 A T 8: 108,949,517 T2400S probably benign Het
Zfp27 T C 7: 29,894,435 T702A probably benign Het
Zfp72 T C 13: 74,371,961 S333G probably benign Het
Other mutations in Gm4788
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Gm4788 APN 1 139731574 missense probably damaging 0.99
IGL01088:Gm4788 APN 1 139698085 utr 3 prime probably benign
IGL01419:Gm4788 APN 1 139739644 critical splice acceptor site probably null
IGL01552:Gm4788 APN 1 139739302 missense probably damaging 1.00
IGL01924:Gm4788 APN 1 139739206 missense probably damaging 0.99
IGL02032:Gm4788 APN 1 139774546 missense probably damaging 1.00
IGL02254:Gm4788 APN 1 139733405 splice site probably benign
IGL02318:Gm4788 APN 1 139781097 missense probably benign 0.20
IGL02527:Gm4788 APN 1 139753045 missense probably damaging 1.00
IGL02531:Gm4788 APN 1 139774569 missense probably benign 0.10
IGL02587:Gm4788 APN 1 139701930 missense probably damaging 1.00
IGL02644:Gm4788 APN 1 139781167 start codon destroyed probably null 0.63
IGL02852:Gm4788 APN 1 139774016 missense probably damaging 1.00
IGL02963:Gm4788 APN 1 139731596 nonsense probably null
IGL03084:Gm4788 APN 1 139781142 missense possibly damaging 0.94
R0131:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0131:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0132:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0549:Gm4788 UTSW 1 139739488 missense probably damaging 1.00
R0558:Gm4788 UTSW 1 139739492 missense probably damaging 0.99
R0610:Gm4788 UTSW 1 139701846 missense probably benign 0.20
R1341:Gm4788 UTSW 1 139732393 missense probably damaging 0.98
R1460:Gm4788 UTSW 1 139698196 missense probably damaging 0.99
R1544:Gm4788 UTSW 1 139736870 missense probably damaging 1.00
R1873:Gm4788 UTSW 1 139774660 missense probably damaging 0.97
R2032:Gm4788 UTSW 1 139733255 splice site probably benign
R2111:Gm4788 UTSW 1 139774679 splice site probably benign
R2179:Gm4788 UTSW 1 139731541 missense probably damaging 1.00
R3806:Gm4788 UTSW 1 139753035 missense probably damaging 1.00
R4356:Gm4788 UTSW 1 139732310 missense probably damaging 1.00
R4747:Gm4788 UTSW 1 139698184 missense probably damaging 1.00
R4838:Gm4788 UTSW 1 139733443 missense probably damaging 1.00
R4867:Gm4788 UTSW 1 139774475 critical splice donor site probably null
R4910:Gm4788 UTSW 1 139774563 missense probably damaging 1.00
R4911:Gm4788 UTSW 1 139774563 missense probably damaging 1.00
R5050:Gm4788 UTSW 1 139736840 missense probably damaging 0.99
R5120:Gm4788 UTSW 1 139753103 missense probably benign 0.39
R5259:Gm4788 UTSW 1 139740495 missense probably damaging 1.00
R5504:Gm4788 UTSW 1 139701820 missense probably benign 0.18
R5825:Gm4788 UTSW 1 139774598 splice site probably null
R5949:Gm4788 UTSW 1 139733149 missense probably damaging 0.98
R6140:Gm4788 UTSW 1 139732395 missense probably damaging 1.00
R6200:Gm4788 UTSW 1 139754335 missense probably damaging 0.97
R6254:Gm4788 UTSW 1 139754390 missense probably damaging 0.98
R6255:Gm4788 UTSW 1 139753011 nonsense probably null
R6334:Gm4788 UTSW 1 139773924 splice site probably null
R6611:Gm4788 UTSW 1 139732390 missense probably damaging 1.00
R6798:Gm4788 UTSW 1 139698121 missense probably benign 0.20
R6895:Gm4788 UTSW 1 139740472 missense possibly damaging 0.84
R6904:Gm4788 UTSW 1 139731653 missense possibly damaging 0.79
R6994:Gm4788 UTSW 1 139736930 missense possibly damaging 0.67
R7173:Gm4788 UTSW 1 139731677 nonsense probably null
R7184:Gm4788 UTSW 1 139733084 missense possibly damaging 0.65
R7192:Gm4788 UTSW 1 139739295 missense probably damaging 0.96
R7205:Gm4788 UTSW 1 139753050 nonsense probably null
R7302:Gm4788 UTSW 1 139739698 splice site probably null
R7308:Gm4788 UTSW 1 139754303 missense possibly damaging 0.71
R7735:Gm4788 UTSW 1 139732301 critical splice donor site probably null
R8006:Gm4788 UTSW 1 139736852 missense probably damaging 1.00
R8045:Gm4788 UTSW 1 139733505 missense probably damaging 0.99
R8188:Gm4788 UTSW 1 139698130 missense probably damaging 1.00
R8339:Gm4788 UTSW 1 139732419 missense probably damaging 1.00
X0009:Gm4788 UTSW 1 139733549 missense probably benign 0.08
X0024:Gm4788 UTSW 1 139733509 missense probably damaging 1.00
Z1088:Gm4788 UTSW 1 139754261 missense probably damaging 0.99
Z1176:Gm4788 UTSW 1 139698256 missense probably benign 0.13
Z1176:Gm4788 UTSW 1 139733448 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGGCTCAGACCACTTTC -3'
(R):5'- TACTAGTACTTGAAGGCTTCAGAG -3'

Sequencing Primer
(F):5'- GTGGCTCAGACCACTTTCCATTTC -3'
(R):5'- CTTCAGAGCAGACATGTTTGC -3'
Posted On2018-09-12