Mutagenetix > Incidental Mutation

Incidental Mutation 'R6800:Vmn2r51'

533264

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r51

Ensembl Gene

ENSMUSG00000058685

Gene Name

vomeronasal 2, receptor 51

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R6800 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

10087198-10105659 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 10098264 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 465 (D465G)

Ref Sequence

ENSEMBL: ENSMUSP00000092459 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094863]

AlphaFold

L7N215

Predicted Effect

probably damaging
Transcript: ENSMUST00000094863
AA Change: D465G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: D465G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.4e-31	PFAM
Pfam:NCD3G	512	565	8.1e-21	PFAM
Pfam:7tm_3	598	833	2.7e-54	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.4%

Validation Efficiency

97% (66/68)

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,288,279	F2091S	probably benign	Het
4930486L24Rik	G	A	13: 60,845,134	P244S	probably damaging	Het
9130023H24Rik	C	A	7: 128,237,570		probably benign	Het
Acoxl	A	T	2: 128,010,165	Q129L	probably damaging	Het
Akna	T	C	4: 63,398,031	T32A	probably benign	Het
Alox15	C	T	11: 70,344,819		probably null	Het
Antxrl	T	C	14: 34,065,907	S296P	probably damaging	Het
Arrb2	G	T	11: 70,437,316	G52*	probably null	Het
BC067074	T	A	13: 113,368,152	D396E	probably benign	Het
Capn2	A	T	1: 182,481,480	I499N	probably damaging	Het
Cubn	T	A	2: 13,321,255	I2700F	probably damaging	Het
Cypt4	A	T	9: 24,625,669	N152Y	probably benign	Het
Dmxl2	T	C	9: 54,409,183	N1640D	probably damaging	Het
Dnah7b	A	T	1: 46,340,217	N3704Y	possibly damaging	Het
Dnah9	A	G	11: 66,072,739		probably null	Het
Elac2	G	A	11: 64,999,439		probably null	Het
Erich3	A	T	3: 154,727,392		probably null	Het
Espnl	T	C	1: 91,342,629	V386A	probably damaging	Het
Fbxl6	T	A	15: 76,538,698		probably benign	Het
Fdps	A	C	3: 89,100,761	F17V	probably damaging	Het
Gigyf2	T	C	1: 87,419,176	I576T	possibly damaging	Het
Gm20939	A	G	17: 94,877,229	E435G	possibly damaging	Het
Gm4788	T	A	1: 139,701,981	D683V	possibly damaging	Het
Hivep1	G	A	13: 42,157,376	V1031I	probably damaging	Het
Hydin	T	G	8: 110,597,971	S4655A	probably benign	Het
Ifrd1	T	A	12: 40,223,158		probably benign	Het
Iqgap1	G	T	7: 80,728,981	T1219K	possibly damaging	Het
Lmtk3	G	A	7: 45,793,809	E639K	possibly damaging	Het
Map3k5	A	G	10: 20,141,580	*1373W	probably null	Het
Mia2	G	A	12: 59,188,546		probably null	Het
Micu2	T	C	14: 57,919,439	D313G	possibly damaging	Het
Mrgpra4	A	G	7: 47,981,623	S77P	probably damaging	Het
Mrpl51	T	C	6: 125,192,404	V17A	probably benign	Het
Neurod4	A	T	10: 130,270,792	Y204*	probably null	Het
Olfr134	A	G	17: 38,175,122	I13V	probably benign	Het
Olfr492	G	A	7: 108,323,253	T141I	probably benign	Het
Olfr682-ps1	A	T	7: 105,127,010	V97E	probably benign	Het
Olfr792	A	T	10: 129,541,263	H242L	probably damaging	Het
Pate2	T	C	9: 35,685,645		probably benign	Het
Pcdhgb8	G	A	18: 37,763,527	R550Q	probably benign	Het
Phldb3	T	C	7: 24,624,152	L437P	possibly damaging	Het
Pianp	C	A	6: 125,001,602	P257T	possibly damaging	Het
Rbbp6	T	A	7: 122,985,064	H140Q	possibly damaging	Het
Rfx2	A	G	17: 56,780,804	I529T	probably damaging	Het
Rnf113a1	A	C	X: 37,192,187	T266P	probably benign	Het
Rp1l1	T	C	14: 64,031,150	I1395T	possibly damaging	Het
Rps6ka2	A	C	17: 7,251,636	K186Q	probably damaging	Het
Rsf1	CGGC	CGGCGGCGGGGGC	7: 97,579,932		probably benign	Het
Rtel1	C	A	2: 181,322,463	T85N	probably benign	Het
Rtn4rl2	T	C	2: 84,880,623	N99S	probably damaging	Het
Ryr1	C	T	7: 29,024,316	G4106D	possibly damaging	Het
Scgb2b24	A	G	7: 33,738,469	V71A	probably benign	Het
Sgip1	A	G	4: 102,921,028		probably benign	Het
Slc12a4	G	A	8: 105,949,739	T515I	probably damaging	Het
Spag1	C	T	15: 36,197,749	R286*	probably null	Het
Strbp	C	T	2: 37,625,216	R266Q	probably damaging	Het
Strn	G	T	17: 78,670,358		probably benign	Het
Thnsl2	C	A	6: 71,141,280	V55L	probably benign	Het
Tmem178b	A	T	6: 40,254,924	Q164L	unknown	Het
Tmprss6	C	T	15: 78,440,257	R786H	probably damaging	Het
Ttc21a	T	A	9: 119,941,202	L113Q	possibly damaging	Het
Ttc21b	T	C	2: 66,208,650		probably null	Het
Vmp1	A	C	11: 86,666,087		probably null	Het
Wdcp	T	C	12: 4,851,358	F405L	probably damaging	Het
Zfhx3	A	T	8: 108,949,517	T2400S	probably benign	Het
Zfp27	T	C	7: 29,894,435	T702A	probably benign	Het
Zfp72	T	C	13: 74,371,961	S333G	probably benign	Het

Other mutations in Vmn2r51

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01398:Vmn2r51	APN	7	10102414	missense	probably benign
IGL01574:Vmn2r51	APN	7	10102454	missense	probably damaging	1.00
IGL01743:Vmn2r51	APN	7	10100227	missense	probably damaging	0.98
IGL01820:Vmn2r51	APN	7	10105482	missense	probably damaging	1.00
IGL02563:Vmn2r51	APN	7	10100316	missense	probably benign	0.00
IGL02825:Vmn2r51	APN	7	10098119	splice site	probably benign
IGL02834:Vmn2r51	APN	7	10098136	nonsense	probably null
R0617:Vmn2r51	UTSW	7	10100469	missense	possibly damaging	0.65
R0967:Vmn2r51	UTSW	7	10100085	missense	probably damaging	0.97
R1465:Vmn2r51	UTSW	7	10100322	missense	probably damaging	1.00
R1465:Vmn2r51	UTSW	7	10100322	missense	probably damaging	1.00
R1559:Vmn2r51	UTSW	7	10102445	missense	possibly damaging	0.58
R1559:Vmn2r51	UTSW	7	10102446	missense	possibly damaging	0.87
R1598:Vmn2r51	UTSW	7	10105505	missense	probably benign
R1754:Vmn2r51	UTSW	7	10099946	missense	probably benign	0.04
R1836:Vmn2r51	UTSW	7	10098163	nonsense	probably null
R1836:Vmn2r51	UTSW	7	10098164	nonsense	probably null
R3151:Vmn2r51	UTSW	7	10100041	missense	probably damaging	1.00
R4566:Vmn2r51	UTSW	7	10102414	missense	probably benign
R4933:Vmn2r51	UTSW	7	10098320	missense	probably damaging	1.00
R5004:Vmn2r51	UTSW	7	10088005	missense	probably benign
R5050:Vmn2r51	UTSW	7	10100422	missense	probably damaging	0.99
R5510:Vmn2r51	UTSW	7	10102618	missense	possibly damaging	0.95
R5559:Vmn2r51	UTSW	7	10092201	missense	probably damaging	1.00
R6127:Vmn2r51	UTSW	7	10105631	missense	probably damaging	1.00
R6154:Vmn2r51	UTSW	7	10087994	missense	possibly damaging	0.74
R6304:Vmn2r51	UTSW	7	10098237	missense	probably benign	0.00
R6370:Vmn2r51	UTSW	7	10098216	missense	probably damaging	1.00
R6471:Vmn2r51	UTSW	7	10102583	missense	possibly damaging	0.48
R6883:Vmn2r51	UTSW	7	10100098	missense	possibly damaging	0.75
R7191:Vmn2r51	UTSW	7	10100553	missense	probably null	1.00
R7246:Vmn2r51	UTSW	7	10102501	missense	probably benign	0.00
R8939:Vmn2r51	UTSW	7	10100026	missense	possibly damaging	0.85
R9154:Vmn2r51	UTSW	7	10105553	missense	probably damaging	0.96
R9428:Vmn2r51	UTSW	7	10099785	critical splice donor site	probably benign
R9451:Vmn2r51	UTSW	7	10099889	missense	probably damaging	1.00
R9729:Vmn2r51	UTSW	7	10105552	missense	probably benign	0.00
R9767:Vmn2r51	UTSW	7	10105480	missense	probably benign	0.09
Z1176:Vmn2r51	UTSW	7	10088057	missense	possibly damaging	0.76
Z1176:Vmn2r51	UTSW	7	10099908	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- TTGCCGTGTATTCATCTGACACTG -3'
(R):5'- GCAATTGCATTTGTTGTGATTCCTC -3'

Sequencing Primer
(F):5'- GTGTATTCATCTGACACTGTTTACTG -3'
(R):5'- GCATTTGTTGTGATTCCTCTCTTTC -3'

Posted On

2018-09-12