Incidental Mutation 'R6800:Zfp27'
ID533267
Institutional Source Beutler Lab
Gene Symbol Zfp27
Ensembl Gene ENSMUSG00000062040
Gene Namezinc finger protein 27
Synonymsmkr-4, Zfp-27
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R6800 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location29893333-29906572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29894435 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 702 (T702A)
Ref Sequence ENSEMBL: ENSMUSP00000127677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053521] [ENSMUST00000159920] [ENSMUST00000161904] [ENSMUST00000162592] [ENSMUST00000172448]
Predicted Effect probably benign
Transcript: ENSMUST00000053521
AA Change: T702A

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000054012
Gene: ENSMUSG00000062040
AA Change: T702A

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159920
AA Change: T702A

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125232
Gene: ENSMUSG00000062040
AA Change: T702A

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161904
AA Change: T702A

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124684
Gene: ENSMUSG00000062040
AA Change: T702A

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162592
AA Change: T702A

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123953
Gene: ENSMUSG00000062040
AA Change: T702A

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172448
AA Change: T702A

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127677
Gene: ENSMUSG00000062040
AA Change: T702A

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,288,279 F2091S probably benign Het
4930486L24Rik G A 13: 60,845,134 P244S probably damaging Het
9130023H24Rik C A 7: 128,237,570 probably benign Het
Acoxl A T 2: 128,010,165 Q129L probably damaging Het
Akna T C 4: 63,398,031 T32A probably benign Het
Alox15 C T 11: 70,344,819 probably null Het
Antxrl T C 14: 34,065,907 S296P probably damaging Het
Arrb2 G T 11: 70,437,316 G52* probably null Het
BC067074 T A 13: 113,368,152 D396E probably benign Het
Capn2 A T 1: 182,481,480 I499N probably damaging Het
Cubn T A 2: 13,321,255 I2700F probably damaging Het
Cypt4 A T 9: 24,625,669 N152Y probably benign Het
Dmxl2 T C 9: 54,409,183 N1640D probably damaging Het
Dnah7b A T 1: 46,340,217 N3704Y possibly damaging Het
Dnah9 A G 11: 66,072,739 probably null Het
Elac2 G A 11: 64,999,439 probably null Het
Erich3 A T 3: 154,727,392 probably null Het
Espnl T C 1: 91,342,629 V386A probably damaging Het
Fbxl6 T A 15: 76,538,698 probably benign Het
Fdps A C 3: 89,100,761 F17V probably damaging Het
Gigyf2 T C 1: 87,419,176 I576T possibly damaging Het
Gm20939 A G 17: 94,877,229 E435G possibly damaging Het
Gm4788 T A 1: 139,701,981 D683V possibly damaging Het
Hivep1 G A 13: 42,157,376 V1031I probably damaging Het
Hydin T G 8: 110,597,971 S4655A probably benign Het
Ifrd1 T A 12: 40,223,158 probably benign Het
Iqgap1 G T 7: 80,728,981 T1219K possibly damaging Het
Lmtk3 G A 7: 45,793,809 E639K possibly damaging Het
Map3k5 A G 10: 20,141,580 *1373W probably null Het
Mia2 G A 12: 59,188,546 probably null Het
Micu2 T C 14: 57,919,439 D313G possibly damaging Het
Mrgpra4 A G 7: 47,981,623 S77P probably damaging Het
Mrpl51 T C 6: 125,192,404 V17A probably benign Het
Neurod4 A T 10: 130,270,792 Y204* probably null Het
Olfr134 A G 17: 38,175,122 I13V probably benign Het
Olfr492 G A 7: 108,323,253 T141I probably benign Het
Olfr682-ps1 A T 7: 105,127,010 V97E probably benign Het
Olfr792 A T 10: 129,541,263 H242L probably damaging Het
Pate2 T C 9: 35,685,645 probably benign Het
Pcdhgb8 G A 18: 37,763,527 R550Q probably benign Het
Phldb3 T C 7: 24,624,152 L437P possibly damaging Het
Pianp C A 6: 125,001,602 P257T possibly damaging Het
Rbbp6 T A 7: 122,985,064 H140Q possibly damaging Het
Rfx2 A G 17: 56,780,804 I529T probably damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Rp1l1 T C 14: 64,031,150 I1395T possibly damaging Het
Rps6ka2 A C 17: 7,251,636 K186Q probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Rtel1 C A 2: 181,322,463 T85N probably benign Het
Rtn4rl2 T C 2: 84,880,623 N99S probably damaging Het
Ryr1 C T 7: 29,024,316 G4106D possibly damaging Het
Scgb2b24 A G 7: 33,738,469 V71A probably benign Het
Sgip1 A G 4: 102,921,028 probably benign Het
Slc12a4 G A 8: 105,949,739 T515I probably damaging Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Strbp C T 2: 37,625,216 R266Q probably damaging Het
Strn G T 17: 78,670,358 probably benign Het
Thnsl2 C A 6: 71,141,280 V55L probably benign Het
Tmem178b A T 6: 40,254,924 Q164L unknown Het
Tmprss6 C T 15: 78,440,257 R786H probably damaging Het
Ttc21a T A 9: 119,941,202 L113Q possibly damaging Het
Ttc21b T C 2: 66,208,650 probably null Het
Vmn2r51 T C 7: 10,098,264 D465G probably damaging Het
Vmp1 A C 11: 86,666,087 probably null Het
Wdcp T C 12: 4,851,358 F405L probably damaging Het
Zfhx3 A T 8: 108,949,517 T2400S probably benign Het
Zfp72 T C 13: 74,371,961 S333G probably benign Het
Other mutations in Zfp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Zfp27 APN 7 29894958 missense probably damaging 0.97
IGL02490:Zfp27 APN 7 29894935 missense possibly damaging 0.73
IGL02899:Zfp27 APN 7 29896255 missense possibly damaging 0.91
R0179:Zfp27 UTSW 7 29896425 missense possibly damaging 0.51
R0234:Zfp27 UTSW 7 29894107 missense possibly damaging 0.73
R0234:Zfp27 UTSW 7 29894107 missense possibly damaging 0.73
R0511:Zfp27 UTSW 7 29894522 missense probably damaging 0.97
R1185:Zfp27 UTSW 7 29895829 missense possibly damaging 0.92
R1185:Zfp27 UTSW 7 29895829 missense possibly damaging 0.92
R1185:Zfp27 UTSW 7 29895829 missense possibly damaging 0.92
R1294:Zfp27 UTSW 7 29896312 missense possibly damaging 0.53
R1581:Zfp27 UTSW 7 29896124 missense possibly damaging 0.53
R1763:Zfp27 UTSW 7 29895376 missense possibly damaging 0.96
R2083:Zfp27 UTSW 7 29894783 missense probably benign 0.06
R2217:Zfp27 UTSW 7 29896111 missense possibly damaging 0.96
R2696:Zfp27 UTSW 7 29896367 missense possibly damaging 0.85
R4084:Zfp27 UTSW 7 29895367 missense possibly damaging 0.91
R4864:Zfp27 UTSW 7 29894836 missense probably damaging 0.99
R6057:Zfp27 UTSW 7 29895019 missense possibly damaging 0.83
R6063:Zfp27 UTSW 7 29894302 missense probably damaging 0.97
R6553:Zfp27 UTSW 7 29896393 missense possibly damaging 0.86
R6585:Zfp27 UTSW 7 29896393 missense possibly damaging 0.86
R7051:Zfp27 UTSW 7 29895021 small deletion probably benign
R7052:Zfp27 UTSW 7 29895021 small deletion probably benign
R7066:Zfp27 UTSW 7 29895021 small deletion probably benign
R7106:Zfp27 UTSW 7 29895021 small deletion probably benign
R7432:Zfp27 UTSW 7 29895359 missense probably benign 0.33
R7473:Zfp27 UTSW 7 29895899 missense possibly damaging 0.71
R7670:Zfp27 UTSW 7 29894796 missense possibly damaging 0.94
R7739:Zfp27 UTSW 7 29894274 missense possibly damaging 0.93
R7817:Zfp27 UTSW 7 29896390 missense possibly damaging 0.96
Z1177:Zfp27 UTSW 7 29895161 missense probably benign 0.33
Z1177:Zfp27 UTSW 7 29896232 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AATGGGTCCTTTCTCATACTGC -3'
(R):5'- GAGCTTTCATCCGCAAGTCC -3'

Sequencing Primer
(F):5'- CATACTGCCGAGGTGTGAACATTC -3'
(R):5'- TCATCCGCAAGTCCAACTTC -3'
Posted On2018-09-12