Incidental Mutation 'R6800:Iqgap1'
ID 533271
Institutional Source Beutler Lab
Gene Symbol Iqgap1
Ensembl Gene ENSMUSG00000030536
Gene Name IQ motif containing GTPase activating protein 1
Synonyms D7Ertd237e, D7Ertd257e
MMRRC Submission 044913-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6800 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 80711583-80825974 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 80728981 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 1219 (T1219K)
Ref Sequence ENSEMBL: ENSMUSP00000128278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167377]
AlphaFold Q9JKF1
Predicted Effect possibly damaging
Transcript: ENSMUST00000167377
AA Change: T1219K

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128278
Gene: ENSMUSG00000030536
AA Change: T1219K

DomainStartEndE-ValueType
CH 46 155 2.02e-20 SMART
internal_repeat_1 203 278 3.71e-8 PROSPERO
low complexity region 324 335 N/A INTRINSIC
low complexity region 390 399 N/A INTRINSIC
coiled coil region 488 515 N/A INTRINSIC
internal_repeat_1 608 684 3.71e-8 PROSPERO
IQ 744 766 3.85e-3 SMART
IQ 774 796 1.12e-4 SMART
IQ 804 826 1.32e-1 SMART
IQ 834 856 1.15e1 SMART
coiled coil region 886 914 N/A INTRINSIC
RasGAP 992 1345 7.46e-89 SMART
Pfam:RasGAP_C 1452 1580 4.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205606
Meta Mutation Damage Score 0.1307 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains four IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. Expression of the protein is upregulated by gene amplification in two gastric cancer cell lines. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a late-onset gastric hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik G A 13: 60,845,134 (GRCm38) P244S probably damaging Het
9130023H24Rik C A 7: 128,237,570 (GRCm38) probably benign Het
Acoxl A T 2: 128,010,165 (GRCm38) Q129L probably damaging Het
Akna T C 4: 63,398,031 (GRCm38) T32A probably benign Het
Alox15 C T 11: 70,344,819 (GRCm38) probably null Het
Antxrl T C 14: 34,065,907 (GRCm38) S296P probably damaging Het
Arrb2 G T 11: 70,437,316 (GRCm38) G52* probably null Het
Bltp2 T C 11: 78,288,279 (GRCm38) F2091S probably benign Het
Capn2 A T 1: 182,481,480 (GRCm38) I499N probably damaging Het
Cfhr4 T A 1: 139,701,981 (GRCm38) D683V possibly damaging Het
Cspg4b T A 13: 113,368,152 (GRCm38) D396E probably benign Het
Cubn T A 2: 13,321,255 (GRCm38) I2700F probably damaging Het
Cypt4 A T 9: 24,625,669 (GRCm38) N152Y probably benign Het
Dmxl2 T C 9: 54,409,183 (GRCm38) N1640D probably damaging Het
Dnah7b A T 1: 46,340,217 (GRCm38) N3704Y possibly damaging Het
Dnah9 A G 11: 66,072,739 (GRCm38) probably null Het
Elac2 G A 11: 64,999,439 (GRCm38) probably null Het
Erich3 A T 3: 154,727,392 (GRCm38) probably null Het
Espnl T C 1: 91,342,629 (GRCm38) V386A probably damaging Het
Fbxl6 T A 15: 76,538,698 (GRCm38) probably benign Het
Fdps A C 3: 89,100,761 (GRCm38) F17V probably damaging Het
Gigyf2 T C 1: 87,419,176 (GRCm38) I576T possibly damaging Het
Gm20939 A G 17: 94,877,229 (GRCm38) E435G possibly damaging Het
Hivep1 G A 13: 42,157,376 (GRCm38) V1031I probably damaging Het
Hydin T G 8: 110,597,971 (GRCm38) S4655A probably benign Het
Ifrd1 T A 12: 40,223,158 (GRCm38) probably benign Het
Lmtk3 G A 7: 45,793,809 (GRCm38) E639K possibly damaging Het
Map3k5 A G 10: 20,141,580 (GRCm38) *1373W probably null Het
Mia2 G A 12: 59,188,546 (GRCm38) probably null Het
Micu2 T C 14: 57,919,439 (GRCm38) D313G possibly damaging Het
Mrgpra4 A G 7: 47,981,623 (GRCm38) S77P probably damaging Het
Mrpl51 T C 6: 125,192,404 (GRCm38) V17A probably benign Het
Neurod4 A T 10: 130,270,792 (GRCm38) Y204* probably null Het
Or2n1 A G 17: 38,175,122 (GRCm38) I13V probably benign Het
Or56a42-ps1 A T 7: 105,127,010 (GRCm38) V97E probably benign Het
Or5p67 G A 7: 108,323,253 (GRCm38) T141I probably benign Het
Or6c66b A T 10: 129,541,263 (GRCm38) H242L probably damaging Het
Pate2 T C 9: 35,685,645 (GRCm38) probably benign Het
Pcdhgb8 G A 18: 37,763,527 (GRCm38) R550Q probably benign Het
Phldb3 T C 7: 24,624,152 (GRCm38) L437P possibly damaging Het
Pianp C A 6: 125,001,602 (GRCm38) P257T possibly damaging Het
Rbbp6 T A 7: 122,985,064 (GRCm38) H140Q possibly damaging Het
Rfx2 A G 17: 56,780,804 (GRCm38) I529T probably damaging Het
Rnf113a1 A C X: 37,192,187 (GRCm38) T266P probably benign Het
Rp1l1 T C 14: 64,031,150 (GRCm38) I1395T possibly damaging Het
Rps6ka2 A C 17: 7,251,636 (GRCm38) K186Q probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 (GRCm38) probably benign Het
Rtel1 C A 2: 181,322,463 (GRCm38) T85N probably benign Het
Rtn4rl2 T C 2: 84,880,623 (GRCm38) N99S probably damaging Het
Ryr1 C T 7: 29,024,316 (GRCm38) G4106D possibly damaging Het
Scgb2b24 A G 7: 33,738,469 (GRCm38) V71A probably benign Het
Sgip1 A G 4: 102,921,028 (GRCm38) probably benign Het
Slc12a4 G A 8: 105,949,739 (GRCm38) T515I probably damaging Het
Spag1 C T 15: 36,197,749 (GRCm38) R286* probably null Het
Strbp C T 2: 37,625,216 (GRCm38) R266Q probably damaging Het
Strn G T 17: 78,670,358 (GRCm38) probably benign Het
Thnsl2 C A 6: 71,141,280 (GRCm38) V55L probably benign Het
Tmem178b A T 6: 40,254,924 (GRCm38) Q164L unknown Het
Tmprss6 C T 15: 78,440,257 (GRCm38) R786H probably damaging Het
Ttc21a T A 9: 119,941,202 (GRCm38) L113Q possibly damaging Het
Ttc21b T C 2: 66,208,650 (GRCm38) probably null Het
Vmn2r51 T C 7: 10,098,264 (GRCm38) D465G probably damaging Het
Vmp1 A C 11: 86,666,087 (GRCm38) probably null Het
Wdcp T C 12: 4,851,358 (GRCm38) F405L probably damaging Het
Zfhx3 A T 8: 108,949,517 (GRCm38) T2400S probably benign Het
Zfp27 T C 7: 29,894,435 (GRCm38) T702A probably benign Het
Zfp72 T C 13: 74,371,961 (GRCm38) S333G probably benign Het
Other mutations in Iqgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Iqgap1 APN 7 80,759,844 (GRCm38) missense probably benign 0.00
IGL00984:Iqgap1 APN 7 80,726,798 (GRCm38) missense probably damaging 1.00
IGL01570:Iqgap1 APN 7 80,723,061 (GRCm38) missense possibly damaging 0.76
IGL01738:Iqgap1 APN 7 80,723,900 (GRCm38) missense possibly damaging 0.80
IGL02141:Iqgap1 APN 7 80,738,121 (GRCm38) missense probably damaging 1.00
IGL02336:Iqgap1 APN 7 80,752,293 (GRCm38) missense probably benign 0.39
IGL02416:Iqgap1 APN 7 80,726,038 (GRCm38) missense probably damaging 1.00
IGL02597:Iqgap1 APN 7 80,723,885 (GRCm38) missense probably damaging 1.00
IGL02662:Iqgap1 APN 7 80,743,079 (GRCm38) missense probably benign
IGL03157:Iqgap1 APN 7 80,751,888 (GRCm38) missense probably benign 0.34
IGL03189:Iqgap1 APN 7 80,713,842 (GRCm38) missense probably benign 0.12
IGL03216:Iqgap1 APN 7 80,743,088 (GRCm38) missense probably benign 0.33
R0024:Iqgap1 UTSW 7 80,751,939 (GRCm38) missense probably benign
R0126:Iqgap1 UTSW 7 80,738,322 (GRCm38) missense probably benign 0.00
R0144:Iqgap1 UTSW 7 80,751,920 (GRCm38) missense probably damaging 1.00
R0325:Iqgap1 UTSW 7 80,751,930 (GRCm38) missense probably benign 0.01
R0376:Iqgap1 UTSW 7 80,723,879 (GRCm38) missense probably benign 0.01
R0650:Iqgap1 UTSW 7 80,736,395 (GRCm38) missense probably damaging 1.00
R0652:Iqgap1 UTSW 7 80,736,395 (GRCm38) missense probably damaging 1.00
R0741:Iqgap1 UTSW 7 80,720,987 (GRCm38) missense probably benign 0.03
R0751:Iqgap1 UTSW 7 80,725,573 (GRCm38) unclassified probably benign
R1067:Iqgap1 UTSW 7 80,723,828 (GRCm38) missense probably benign 0.01
R1389:Iqgap1 UTSW 7 80,759,756 (GRCm38) critical splice donor site probably null
R1473:Iqgap1 UTSW 7 80,734,011 (GRCm38) missense probably benign 0.00
R1613:Iqgap1 UTSW 7 80,768,457 (GRCm38) missense probably damaging 1.00
R1842:Iqgap1 UTSW 7 80,760,883 (GRCm38) missense probably damaging 1.00
R1909:Iqgap1 UTSW 7 80,743,828 (GRCm38) missense probably benign
R2062:Iqgap1 UTSW 7 80,723,979 (GRCm38) nonsense probably null
R2149:Iqgap1 UTSW 7 80,762,560 (GRCm38) missense probably damaging 1.00
R2153:Iqgap1 UTSW 7 80,759,903 (GRCm38) missense possibly damaging 0.55
R2153:Iqgap1 UTSW 7 80,751,953 (GRCm38) missense probably benign 0.00
R3160:Iqgap1 UTSW 7 80,752,338 (GRCm38) missense probably benign
R3162:Iqgap1 UTSW 7 80,752,338 (GRCm38) missense probably benign
R3605:Iqgap1 UTSW 7 80,723,789 (GRCm38) missense probably benign 0.02
R3709:Iqgap1 UTSW 7 80,717,087 (GRCm38) missense possibly damaging 0.87
R3935:Iqgap1 UTSW 7 80,743,837 (GRCm38) missense possibly damaging 0.54
R3979:Iqgap1 UTSW 7 80,759,934 (GRCm38) missense probably damaging 0.98
R4545:Iqgap1 UTSW 7 80,762,567 (GRCm38) critical splice acceptor site probably null
R4787:Iqgap1 UTSW 7 80,735,513 (GRCm38) missense probably damaging 1.00
R4925:Iqgap1 UTSW 7 80,765,317 (GRCm38) missense probably damaging 1.00
R4953:Iqgap1 UTSW 7 80,723,776 (GRCm38) splice site probably null
R5037:Iqgap1 UTSW 7 80,734,100 (GRCm38) missense probably damaging 1.00
R5158:Iqgap1 UTSW 7 80,743,068 (GRCm38) missense probably benign 0.02
R5183:Iqgap1 UTSW 7 80,723,065 (GRCm38) missense probably damaging 1.00
R5262:Iqgap1 UTSW 7 80,726,742 (GRCm38) missense probably benign 0.00
R5271:Iqgap1 UTSW 7 80,734,148 (GRCm38) missense probably damaging 1.00
R5289:Iqgap1 UTSW 7 80,738,724 (GRCm38) missense possibly damaging 0.88
R5359:Iqgap1 UTSW 7 80,766,959 (GRCm38) missense probably benign 0.00
R5423:Iqgap1 UTSW 7 80,799,862 (GRCm38) missense probably damaging 1.00
R5843:Iqgap1 UTSW 7 80,726,080 (GRCm38) missense probably benign 0.03
R5849:Iqgap1 UTSW 7 80,803,158 (GRCm38) missense probably benign
R6164:Iqgap1 UTSW 7 80,809,106 (GRCm38) missense unknown
R6315:Iqgap1 UTSW 7 80,799,890 (GRCm38) missense possibly damaging 0.65
R6335:Iqgap1 UTSW 7 80,728,024 (GRCm38) missense probably damaging 1.00
R6488:Iqgap1 UTSW 7 80,730,326 (GRCm38) missense probably benign 0.00
R6723:Iqgap1 UTSW 7 80,723,822 (GRCm38) missense probably benign 0.01
R6815:Iqgap1 UTSW 7 80,766,884 (GRCm38) critical splice donor site probably null
R7240:Iqgap1 UTSW 7 80,759,839 (GRCm38) missense probably benign 0.22
R7386:Iqgap1 UTSW 7 80,726,042 (GRCm38) missense probably damaging 1.00
R7387:Iqgap1 UTSW 7 80,720,990 (GRCm38) missense probably benign 0.03
R7410:Iqgap1 UTSW 7 80,723,030 (GRCm38) nonsense probably null
R7429:Iqgap1 UTSW 7 80,751,440 (GRCm38) missense probably benign 0.00
R7452:Iqgap1 UTSW 7 80,760,829 (GRCm38) missense possibly damaging 0.80
R7615:Iqgap1 UTSW 7 80,751,346 (GRCm38) missense probably benign
R7615:Iqgap1 UTSW 7 80,730,100 (GRCm38) missense probably damaging 1.00
R7726:Iqgap1 UTSW 7 80,757,456 (GRCm38) missense probably benign 0.37
R7783:Iqgap1 UTSW 7 80,809,059 (GRCm38) missense probably benign 0.01
R7785:Iqgap1 UTSW 7 80,738,169 (GRCm38) missense probably damaging 1.00
R7862:Iqgap1 UTSW 7 80,743,888 (GRCm38) missense probably benign 0.04
R8270:Iqgap1 UTSW 7 80,730,127 (GRCm38) missense probably damaging 1.00
R8556:Iqgap1 UTSW 7 80,726,039 (GRCm38) missense probably damaging 1.00
R8932:Iqgap1 UTSW 7 80,751,393 (GRCm38) missense probably benign
R9520:Iqgap1 UTSW 7 80,744,121 (GRCm38) missense probably benign
R9533:Iqgap1 UTSW 7 80,734,181 (GRCm38) missense possibly damaging 0.88
R9536:Iqgap1 UTSW 7 80,809,092 (GRCm38) missense
R9730:Iqgap1 UTSW 7 80,751,376 (GRCm38) missense possibly damaging 0.63
RF004:Iqgap1 UTSW 7 80,720,875 (GRCm38) missense probably benign
RF063:Iqgap1 UTSW 7 80,723,751 (GRCm38) frame shift probably null
X0064:Iqgap1 UTSW 7 80,720,931 (GRCm38) nonsense probably null
X0067:Iqgap1 UTSW 7 80,766,903 (GRCm38) missense probably benign
Z1176:Iqgap1 UTSW 7 80,768,309 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACCTACAGACCTTTGAGTCG -3'
(R):5'- TGGAGCGTTGGATCACATACC -3'

Sequencing Primer
(F):5'- ACAGACCTTTGAGTCGTCTAC -3'
(R):5'- GAGCGTTGGATCACATACCTTACAG -3'
Posted On 2018-09-12