Incidental Mutation 'R6800:Slc12a4'
ID533277
Institutional Source Beutler Lab
Gene Symbol Slc12a4
Ensembl Gene ENSMUSG00000017765
Gene Namesolute carrier family 12, member 4
SynonymsKCC1, K-Cl Co-transporter-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R6800 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105943590-105966097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105949739 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 515 (T515I)
Ref Sequence ENSEMBL: ENSMUSP00000112130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034370] [ENSMUST00000116429]
Predicted Effect probably damaging
Transcript: ENSMUST00000034370
AA Change: T517I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034370
Gene: ENSMUSG00000017765
AA Change: T517I

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
Pfam:AA_permease 125 318 5.8e-28 PFAM
Pfam:AA_permease 409 698 1.2e-40 PFAM
Pfam:SLC12 710 833 7.1e-18 PFAM
Pfam:SLC12 829 1087 4.8e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116429
AA Change: T515I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112130
Gene: ENSMUSG00000017765
AA Change: T515I

DomainStartEndE-ValueType
low complexity region 95 115 N/A INTRINSIC
Pfam:AA_permease 123 309 7.7e-29 PFAM
Pfam:AA_permease_2 390 654 2.9e-17 PFAM
Pfam:AA_permease 404 696 4.4e-39 PFAM
Pfam:KCl_Cotrans_1 953 982 9.2e-21 PFAM
low complexity region 1065 1080 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132231
SMART Domains Protein: ENSMUSP00000121018
Gene: ENSMUSG00000017765

DomainStartEndE-ValueType
low complexity region 66 86 N/A INTRINSIC
Pfam:AA_permease 94 171 1.3e-19 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC12A transporter family. The encoded protein mediates the coupled movement of potassium and chloride ions across the plasma membrane. This gene is expressed ubiquitously. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a constitutively active mutation display microcytosis and hypochromic anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,288,279 F2091S probably benign Het
4930486L24Rik G A 13: 60,845,134 P244S probably damaging Het
9130023H24Rik C A 7: 128,237,570 probably benign Het
Acoxl A T 2: 128,010,165 Q129L probably damaging Het
Akna T C 4: 63,398,031 T32A probably benign Het
Alox15 C T 11: 70,344,819 probably null Het
Antxrl T C 14: 34,065,907 S296P probably damaging Het
Arrb2 G T 11: 70,437,316 G52* probably null Het
BC067074 T A 13: 113,368,152 D396E probably benign Het
Capn2 A T 1: 182,481,480 I499N probably damaging Het
Cubn T A 2: 13,321,255 I2700F probably damaging Het
Cypt4 A T 9: 24,625,669 N152Y probably benign Het
Dmxl2 T C 9: 54,409,183 N1640D probably damaging Het
Dnah7b A T 1: 46,340,217 N3704Y possibly damaging Het
Dnah9 A G 11: 66,072,739 probably null Het
Elac2 G A 11: 64,999,439 probably null Het
Erich3 A T 3: 154,727,392 probably null Het
Espnl T C 1: 91,342,629 V386A probably damaging Het
Fbxl6 T A 15: 76,538,698 probably benign Het
Fdps A C 3: 89,100,761 F17V probably damaging Het
Gigyf2 T C 1: 87,419,176 I576T possibly damaging Het
Gm20939 A G 17: 94,877,229 E435G possibly damaging Het
Gm4788 T A 1: 139,701,981 D683V possibly damaging Het
Hivep1 G A 13: 42,157,376 V1031I probably damaging Het
Hydin T G 8: 110,597,971 S4655A probably benign Het
Ifrd1 T A 12: 40,223,158 probably benign Het
Iqgap1 G T 7: 80,728,981 T1219K possibly damaging Het
Lmtk3 G A 7: 45,793,809 E639K possibly damaging Het
Map3k5 A G 10: 20,141,580 *1373W probably null Het
Mia2 G A 12: 59,188,546 probably null Het
Micu2 T C 14: 57,919,439 D313G possibly damaging Het
Mrgpra4 A G 7: 47,981,623 S77P probably damaging Het
Mrpl51 T C 6: 125,192,404 V17A probably benign Het
Neurod4 A T 10: 130,270,792 Y204* probably null Het
Olfr134 A G 17: 38,175,122 I13V probably benign Het
Olfr492 G A 7: 108,323,253 T141I probably benign Het
Olfr682-ps1 A T 7: 105,127,010 V97E probably benign Het
Olfr792 A T 10: 129,541,263 H242L probably damaging Het
Pate2 T C 9: 35,685,645 probably benign Het
Pcdhgb8 G A 18: 37,763,527 R550Q probably benign Het
Phldb3 T C 7: 24,624,152 L437P possibly damaging Het
Pianp C A 6: 125,001,602 P257T possibly damaging Het
Rbbp6 T A 7: 122,985,064 H140Q possibly damaging Het
Rfx2 A G 17: 56,780,804 I529T probably damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Rp1l1 T C 14: 64,031,150 I1395T possibly damaging Het
Rps6ka2 A C 17: 7,251,636 K186Q probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Rtel1 C A 2: 181,322,463 T85N probably benign Het
Rtn4rl2 T C 2: 84,880,623 N99S probably damaging Het
Ryr1 C T 7: 29,024,316 G4106D possibly damaging Het
Scgb2b24 A G 7: 33,738,469 V71A probably benign Het
Sgip1 A G 4: 102,921,028 probably benign Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Strbp C T 2: 37,625,216 R266Q probably damaging Het
Strn G T 17: 78,670,358 probably benign Het
Thnsl2 C A 6: 71,141,280 V55L probably benign Het
Tmem178b A T 6: 40,254,924 Q164L unknown Het
Tmprss6 C T 15: 78,440,257 R786H probably damaging Het
Ttc21a T A 9: 119,941,202 L113Q possibly damaging Het
Ttc21b T C 2: 66,208,650 probably null Het
Vmn2r51 T C 7: 10,098,264 D465G probably damaging Het
Vmp1 A C 11: 86,666,087 probably null Het
Wdcp T C 12: 4,851,358 F405L probably damaging Het
Zfhx3 A T 8: 108,949,517 T2400S probably benign Het
Zfp27 T C 7: 29,894,435 T702A probably benign Het
Zfp72 T C 13: 74,371,961 S333G probably benign Het
Other mutations in Slc12a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Slc12a4 APN 8 105944089 missense probably damaging 1.00
IGL01637:Slc12a4 APN 8 105960707 missense possibly damaging 0.72
IGL01736:Slc12a4 APN 8 105945843 critical splice donor site probably null
IGL01804:Slc12a4 APN 8 105944401 missense probably damaging 1.00
IGL02000:Slc12a4 APN 8 105945232 missense probably damaging 1.00
IGL02526:Slc12a4 APN 8 105949806 missense possibly damaging 0.90
IGL03371:Slc12a4 APN 8 105950505 missense probably null 0.99
IGL03385:Slc12a4 APN 8 105950864 unclassified probably benign
PIT4810001:Slc12a4 UTSW 8 105951596 missense probably benign 0.00
R0033:Slc12a4 UTSW 8 105947479 splice site probably benign
R0200:Slc12a4 UTSW 8 105951617 missense probably benign 0.09
R0201:Slc12a4 UTSW 8 105945350 missense possibly damaging 0.79
R0270:Slc12a4 UTSW 8 105945389 missense probably benign 0.10
R0389:Slc12a4 UTSW 8 105951967 missense probably benign 0.00
R0432:Slc12a4 UTSW 8 105959488 missense probably damaging 1.00
R0751:Slc12a4 UTSW 8 105951900 missense probably damaging 1.00
R1717:Slc12a4 UTSW 8 105947571 splice site probably null
R1792:Slc12a4 UTSW 8 105951843 missense possibly damaging 0.91
R1940:Slc12a4 UTSW 8 105946037 missense probably benign 0.29
R3115:Slc12a4 UTSW 8 105959459 missense probably damaging 1.00
R4898:Slc12a4 UTSW 8 105944609 missense probably damaging 1.00
R5182:Slc12a4 UTSW 8 105944606 missense probably damaging 1.00
R5220:Slc12a4 UTSW 8 105953852 missense probably damaging 1.00
R5283:Slc12a4 UTSW 8 105950694 critical splice donor site probably null
R5367:Slc12a4 UTSW 8 105951634 missense probably damaging 0.99
R5610:Slc12a4 UTSW 8 105950213 missense possibly damaging 0.87
R5921:Slc12a4 UTSW 8 105945244 critical splice acceptor site probably null
R6060:Slc12a4 UTSW 8 105945706 missense probably damaging 1.00
R6182:Slc12a4 UTSW 8 105947899 missense probably damaging 1.00
R6722:Slc12a4 UTSW 8 105944250 splice site probably null
R6956:Slc12a4 UTSW 8 105953852 missense probably damaging 1.00
R7032:Slc12a4 UTSW 8 105949233 missense probably damaging 1.00
R7092:Slc12a4 UTSW 8 105945223 missense probably damaging 1.00
R7229:Slc12a4 UTSW 8 105946737 missense probably benign 0.05
R7243:Slc12a4 UTSW 8 105953920 missense probably damaging 1.00
R7323:Slc12a4 UTSW 8 105955715 missense probably damaging 1.00
R7325:Slc12a4 UTSW 8 105955715 missense probably damaging 1.00
R7327:Slc12a4 UTSW 8 105955715 missense probably damaging 1.00
R7426:Slc12a4 UTSW 8 105950836 missense probably benign 0.00
R7569:Slc12a4 UTSW 8 105945847 missense probably damaging 1.00
R7710:Slc12a4 UTSW 8 105945571 missense possibly damaging 0.95
R7968:Slc12a4 UTSW 8 105951605 missense possibly damaging 0.94
R7970:Slc12a4 UTSW 8 105951605 missense possibly damaging 0.94
R7971:Slc12a4 UTSW 8 105951605 missense possibly damaging 0.94
R7972:Slc12a4 UTSW 8 105951605 missense possibly damaging 0.94
R7973:Slc12a4 UTSW 8 105951605 missense possibly damaging 0.94
R8221:Slc12a4 UTSW 8 105951969 missense probably benign 0.00
R8386:Slc12a4 UTSW 8 105951618 missense probably damaging 1.00
R8393:Slc12a4 UTSW 8 105951819 missense probably damaging 0.99
X0019:Slc12a4 UTSW 8 105944352 missense probably damaging 0.98
Z1177:Slc12a4 UTSW 8 105946732 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGCATCTGAATCTGCCTGCC -3'
(R):5'- ACTCAAAGCTAGAGCCTCTTCTC -3'

Sequencing Primer
(F):5'- AATCTGCCTGCCCACGC -3'
(R):5'- TACGGTGATGGCGTCAG -3'
Posted On2018-09-12