Mutagenetix > Incidental Mutations

Incidental Mutation 'R6800:Map3k5'

533284

Institutional Source

Beutler Lab

Gene Symbol

Map3k5

Ensembl Gene

ENSMUSG00000071369

Gene Name

mitogen-activated protein kinase kinase kinase 5

Synonyms

ASK, ASK1, 7420452D20Rik, Mekk5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6800 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

19934472-20142753 bp(+) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

A to G at 20141580 bp

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Tryptophan at position 1373 (*1373W)

Ref Sequence

ENSEMBL: ENSMUSP00000112864 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095806] [ENSMUST00000120259]

Predicted Effect

probably null
Transcript: ENSMUST00000095806
AA Change: *1381W

SMART Domains

Protein: ENSMUSP00000093485
Gene: ENSMUSG00000071369
AA Change: *1381W

Domain	Start	End	E-Value	Type
low complexity region	26	43	N/A	INTRINSIC
low complexity region	44	58	N/A	INTRINSIC
low complexity region	80	99	N/A	INTRINSIC
Pfam:DUF4071	172	552	2.1e-162	PFAM
S_TKc	687	945	8.08e-92	SMART
low complexity region	1195	1207	N/A	INTRINSIC
low complexity region	1225	1238	N/A	INTRINSIC
coiled coil region	1251	1292	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000120259
AA Change: *1373W

SMART Domains

Protein: ENSMUSP00000112864
Gene: ENSMUSG00000071369
AA Change: *1373W

Domain	Start	End	E-Value	Type
low complexity region	26	43	N/A	INTRINSIC
low complexity region	44	58	N/A	INTRINSIC
low complexity region	80	99	N/A	INTRINSIC
Pfam:DUF4071	172	544	1.7e-156	PFAM
S_TKc	679	937	8.08e-92	SMART
low complexity region	1187	1199	N/A	INTRINSIC
low complexity region	1217	1230	N/A	INTRINSIC
coiled coil region	1243	1284	N/A	INTRINSIC

Meta Mutation Damage Score

0.8621

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.4%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitogen-activated protein kinase (MAPK) signaling cascades include MAPK or extracellular signal-regulated kinase (ERK), MAPK kinase (MKK or MEK), and MAPK kinase kinase (MAPKKK or MEKK). MAPKK kinase/MEKK phosphorylates and activates its downstream protein kinase, MAPK kinase/MEK, which in turn activates MAPK. The kinases of these signaling cascades are highly conserved, and homologs exist in yeast, Drosophila, and mammalian cells. MAPKKK5 contains 1,374 amino acids with all 11 kinase subdomains. Northern blot analysis shows that MAPKKK5 transcript is abundantly expressed in human heart and pancreas. The MAPKKK5 protein phosphorylates and activates MKK4 (aliases SERK1, MAPKK4) in vitro, and activates c-Jun N-terminal kinase (JNK)/stress-activated protein kinase (SAPK) during transient expression in COS and 293 cells; MAPKKK5 does not activate MAPK/ERK. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are overtly normal, however apoptosis abnormalities are evident in cultured cells and after induced heart damage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,288,279	F2091S	probably benign	Het
4930486L24Rik	G	A	13: 60,845,134	P244S	probably damaging	Het
9130023H24Rik	C	A	7: 128,237,570		probably benign	Het
Acoxl	A	T	2: 128,010,165	Q129L	probably damaging	Het
Akna	T	C	4: 63,398,031	T32A	probably benign	Het
Alox15	C	T	11: 70,344,819		probably null	Het
Antxrl	T	C	14: 34,065,907	S296P	probably damaging	Het
Arrb2	G	T	11: 70,437,316	G52*	probably null	Het
BC067074	T	A	13: 113,368,152	D396E	probably benign	Het
Capn2	A	T	1: 182,481,480	I499N	probably damaging	Het
Cubn	T	A	2: 13,321,255	I2700F	probably damaging	Het
Cypt4	A	T	9: 24,625,669	N152Y	probably benign	Het
Dmxl2	T	C	9: 54,409,183	N1640D	probably damaging	Het
Dnah7b	A	T	1: 46,340,217	N3704Y	possibly damaging	Het
Dnah9	A	G	11: 66,072,739		probably null	Het
Elac2	G	A	11: 64,999,439		probably null	Het
Erich3	A	T	3: 154,727,392		probably null	Het
Espnl	T	C	1: 91,342,629	V386A	probably damaging	Het
Fbxl6	T	A	15: 76,538,698		probably benign	Het
Fdps	A	C	3: 89,100,761	F17V	probably damaging	Het
Gigyf2	T	C	1: 87,419,176	I576T	possibly damaging	Het
Gm20939	A	G	17: 94,877,229	E435G	possibly damaging	Het
Gm4788	T	A	1: 139,701,981	D683V	possibly damaging	Het
Hivep1	G	A	13: 42,157,376	V1031I	probably damaging	Het
Hydin	T	G	8: 110,597,971	S4655A	probably benign	Het
Ifrd1	T	A	12: 40,223,158		probably benign	Het
Iqgap1	G	T	7: 80,728,981	T1219K	possibly damaging	Het
Lmtk3	G	A	7: 45,793,809	E639K	possibly damaging	Het
Mia2	G	A	12: 59,188,546		probably null	Het
Micu2	T	C	14: 57,919,439	D313G	possibly damaging	Het
Mrgpra4	A	G	7: 47,981,623	S77P	probably damaging	Het
Mrpl51	T	C	6: 125,192,404	V17A	probably benign	Het
Neurod4	A	T	10: 130,270,792	Y204*	probably null	Het
Olfr134	A	G	17: 38,175,122	I13V	probably benign	Het
Olfr492	G	A	7: 108,323,253	T141I	probably benign	Het
Olfr682-ps1	A	T	7: 105,127,010	V97E	probably benign	Het
Olfr792	A	T	10: 129,541,263	H242L	probably damaging	Het
Pate2	T	C	9: 35,685,645		probably benign	Het
Pcdhgb8	G	A	18: 37,763,527	R550Q	probably benign	Het
Phldb3	T	C	7: 24,624,152	L437P	possibly damaging	Het
Pianp	C	A	6: 125,001,602	P257T	possibly damaging	Het
Rbbp6	T	A	7: 122,985,064	H140Q	possibly damaging	Het
Rfx2	A	G	17: 56,780,804	I529T	probably damaging	Het
Rnf113a1	A	C	X: 37,192,187	T266P	probably benign	Het
Rp1l1	T	C	14: 64,031,150	I1395T	possibly damaging	Het
Rps6ka2	A	C	17: 7,251,636	K186Q	probably damaging	Het
Rsf1	CGGC	CGGCGGCGGGGGC	7: 97,579,932		probably benign	Het
Rtel1	C	A	2: 181,322,463	T85N	probably benign	Het
Rtn4rl2	T	C	2: 84,880,623	N99S	probably damaging	Het
Ryr1	C	T	7: 29,024,316	G4106D	possibly damaging	Het
Scgb2b24	A	G	7: 33,738,469	V71A	probably benign	Het
Sgip1	A	G	4: 102,921,028		probably benign	Het
Slc12a4	G	A	8: 105,949,739	T515I	probably damaging	Het
Spag1	C	T	15: 36,197,749	R286*	probably null	Het
Strbp	C	T	2: 37,625,216	R266Q	probably damaging	Het
Strn	G	T	17: 78,670,358		probably benign	Het
Thnsl2	C	A	6: 71,141,280	V55L	probably benign	Het
Tmem178b	A	T	6: 40,254,924	Q164L	unknown	Het
Tmprss6	C	T	15: 78,440,257	R786H	probably damaging	Het
Ttc21a	T	A	9: 119,941,202	L113Q	possibly damaging	Het
Ttc21b	T	C	2: 66,208,650		probably null	Het
Vmn2r51	T	C	7: 10,098,264	D465G	probably damaging	Het
Vmp1	A	C	11: 86,666,087		probably null	Het
Wdcp	T	C	12: 4,851,358	F405L	probably damaging	Het
Zfhx3	A	T	8: 108,949,517	T2400S	probably benign	Het
Zfp27	T	C	7: 29,894,435	T702A	probably benign	Het
Zfp72	T	C	13: 74,371,961	S333G	probably benign	Het

Other mutations in Map3k5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Map3k5	APN	10	19935044	missense	possibly damaging	0.73
IGL00978:Map3k5	APN	10	20141567	missense	probably damaging	1.00
IGL01470:Map3k5	APN	10	20118187	missense	possibly damaging	0.89
IGL01992:Map3k5	APN	10	20029133	nonsense	probably null
IGL02479:Map3k5	APN	10	20056484	missense	probably damaging	1.00
IGL02728:Map3k5	APN	10	20118292	missense	possibly damaging	0.71
IGL02812:Map3k5	APN	10	20025036	missense	probably damaging	1.00
IGL03104:Map3k5	APN	10	20132055	missense	probably benign
P0033:Map3k5	UTSW	10	20132213	splice site	probably benign
PIT4434001:Map3k5	UTSW	10	20026257	missense	probably damaging	0.98
R0284:Map3k5	UTSW	10	20000613	missense	probably damaging	0.99
R1103:Map3k5	UTSW	10	20023676	missense	probably benign	0.00
R1172:Map3k5	UTSW	10	20056648	intron	probably benign
R1250:Map3k5	UTSW	10	20110775	missense	possibly damaging	0.73
R1493:Map3k5	UTSW	10	20029113	missense	probably damaging	1.00
R1634:Map3k5	UTSW	10	20136911	missense	possibly damaging	0.64
R1693:Map3k5	UTSW	10	20104242	missense	probably damaging	1.00
R1713:Map3k5	UTSW	10	20110847	missense	possibly damaging	0.79
R1832:Map3k5	UTSW	10	20099560	missense	probably damaging	1.00
R1844:Map3k5	UTSW	10	20104163	missense	probably benign	0.33
R1869:Map3k5	UTSW	10	20132109	nonsense	probably null
R2156:Map3k5	UTSW	10	20024937	missense	probably damaging	1.00
R2214:Map3k5	UTSW	10	20026289	critical splice donor site	probably null
R2221:Map3k5	UTSW	10	20067920	missense	possibly damaging	0.96
R2223:Map3k5	UTSW	10	20067920	missense	possibly damaging	0.96
R2249:Map3k5	UTSW	10	20127697	missense	probably damaging	0.99
R2418:Map3k5	UTSW	10	20110857	missense	probably benign	0.02
R2513:Map3k5	UTSW	10	20094455	missense	possibly damaging	0.92
R3014:Map3k5	UTSW	10	20094429	missense	probably damaging	1.00
R3770:Map3k5	UTSW	10	20025019	missense	probably damaging	0.99
R3814:Map3k5	UTSW	10	20026190	missense	probably damaging	0.99
R3814:Map3k5	UTSW	10	20140680	missense	probably damaging	0.99
R4706:Map3k5	UTSW	10	20058938	missense	probably damaging	1.00
R4749:Map3k5	UTSW	10	20132052	missense	probably benign	0.42
R4903:Map3k5	UTSW	10	20118489	missense	probably null	1.00
R4958:Map3k5	UTSW	10	20023789	missense	possibly damaging	0.79
R5065:Map3k5	UTSW	10	20082467	missense	probably damaging	1.00
R5210:Map3k5	UTSW	10	20024901	missense	possibly damaging	0.82
R5245:Map3k5	UTSW	10	20140691	missense	probably benign	0.00
R5304:Map3k5	UTSW	10	20108238	missense	probably benign	0.13
R5428:Map3k5	UTSW	10	20023653	missense	possibly damaging	0.93
R5566:Map3k5	UTSW	10	20110719	missense	probably damaging	1.00
R5914:Map3k5	UTSW	10	20104255	missense	probably benign	0.24
R6155:Map3k5	UTSW	10	20118441	missense	probably benign	0.01
R6161:Map3k5	UTSW	10	20000575	missense	probably damaging	0.98
R6191:Map3k5	UTSW	10	20023669	missense	probably damaging	0.99
R6251:Map3k5	UTSW	10	20138260	splice site	probably null
R7304:Map3k5	UTSW	10	20099555	missense	probably damaging	1.00
R7722:Map3k5	UTSW	10	20132145	missense	probably benign	0.04
R8058:Map3k5	UTSW	10	20132114	missense	probably damaging	0.99
R8207:Map3k5	UTSW	10	20110866	frame shift	probably null
R8827:Map3k5	UTSW	10	20026257	missense	probably damaging	0.98
R8977:Map3k5	UTSW	10	20079254	missense	possibly damaging	0.88
RF024:Map3k5	UTSW	10	20100172	missense	probably damaging	1.00
X0017:Map3k5	UTSW	10	20118434	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCTCGACACGTTTTCACCAG -3'
(R):5'- CAGTCAGGATTATTCTGAAAGCC -3'

Sequencing Primer
(F):5'- TCGACACGTTTTCACCAGAGGAG -3'
(R):5'- TCTGAAAGCCTTTGTGAAGAAGAGTC -3'

Posted On

2018-09-12