Incidental Mutation 'R6800:Ifrd1'
List |< first << previous [record 26 of 68] next >> last >|
ID533293
Institutional Source Beutler Lab
Gene Symbol Ifrd1
Ensembl Gene ENSMUSG00000001627
Gene Nameinterferon-related developmental regulator 1
SynonymsTis7, PC4, Ifnl
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.597) question?
Stock #R6800 (G1)
Quality Score204.009
Status Validated
Chromosome12
Chromosomal Location40201567-40248504 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 40223158 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001672] [ENSMUST00000164354] [ENSMUST00000169319] [ENSMUST00000169926] [ENSMUST00000171530]
Predicted Effect probably benign
Transcript: ENSMUST00000001672
SMART Domains Protein: ENSMUSP00000001672
Gene: ENSMUSG00000001627

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
Pfam:IFRD 40 345 1.1e-115 PFAM
Pfam:IFRD_C 390 443 6.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164354
SMART Domains Protein: ENSMUSP00000130846
Gene: ENSMUSG00000001627

DomainStartEndE-ValueType
Pfam:IFRD 1 87 1.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169319
SMART Domains Protein: ENSMUSP00000130824
Gene: ENSMUSG00000001627

DomainStartEndE-ValueType
Pfam:IFRD 1 100 8.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169926
SMART Domains Protein: ENSMUSP00000127673
Gene: ENSMUSG00000001627

DomainStartEndE-ValueType
Pfam:IFRD 1 138 5.6e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171530
SMART Domains Protein: ENSMUSP00000128635
Gene: ENSMUSG00000001627

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
Pfam:IFRD 40 137 1.8e-33 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an immediate early gene that encodes a protein related to interferon-gamma. This protein may function as a transcriptional co-activator/repressor that controls the growth and differentiation of specific cell types during embryonic development and tissue regeneration. Mutations in this gene are associated with sensory/motor neuropathy with ataxia. This gene may also be involved in modulating the pathogenesis of cystic fibrosis lung disease. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous null mice display impaired muscle regeneration and myogenic differentiation and decreased body weight in older mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,288,279 F2091S probably benign Het
4930486L24Rik G A 13: 60,845,134 P244S probably damaging Het
9130023H24Rik C A 7: 128,237,570 probably benign Het
Acoxl A T 2: 128,010,165 Q129L probably damaging Het
Akna T C 4: 63,398,031 T32A probably benign Het
Alox15 C T 11: 70,344,819 probably null Het
Antxrl T C 14: 34,065,907 S296P probably damaging Het
Arrb2 G T 11: 70,437,316 G52* probably null Het
BC067074 T A 13: 113,368,152 D396E probably benign Het
Capn2 A T 1: 182,481,480 I499N probably damaging Het
Cubn T A 2: 13,321,255 I2700F probably damaging Het
Cypt4 A T 9: 24,625,669 N152Y probably benign Het
Dmxl2 T C 9: 54,409,183 N1640D probably damaging Het
Dnah7b A T 1: 46,340,217 N3704Y possibly damaging Het
Dnah9 A G 11: 66,072,739 probably null Het
Elac2 G A 11: 64,999,439 probably null Het
Erich3 A T 3: 154,727,392 probably null Het
Espnl T C 1: 91,342,629 V386A probably damaging Het
Fbxl6 T A 15: 76,538,698 probably benign Het
Fdps A C 3: 89,100,761 F17V probably damaging Het
Gigyf2 T C 1: 87,419,176 I576T possibly damaging Het
Gm20939 A G 17: 94,877,229 E435G possibly damaging Het
Gm4788 T A 1: 139,701,981 D683V possibly damaging Het
Hivep1 G A 13: 42,157,376 V1031I probably damaging Het
Hydin T G 8: 110,597,971 S4655A probably benign Het
Iqgap1 G T 7: 80,728,981 T1219K possibly damaging Het
Lmtk3 G A 7: 45,793,809 E639K possibly damaging Het
Map3k5 A G 10: 20,141,580 *1373W probably null Het
Mia2 G A 12: 59,188,546 probably null Het
Micu2 T C 14: 57,919,439 D313G possibly damaging Het
Mrgpra4 A G 7: 47,981,623 S77P probably damaging Het
Mrpl51 T C 6: 125,192,404 V17A probably benign Het
Neurod4 A T 10: 130,270,792 Y204* probably null Het
Olfr134 A G 17: 38,175,122 I13V probably benign Het
Olfr492 G A 7: 108,323,253 T141I probably benign Het
Olfr682-ps1 A T 7: 105,127,010 V97E probably benign Het
Olfr792 A T 10: 129,541,263 H242L probably damaging Het
Pate2 T C 9: 35,685,645 probably benign Het
Pcdhgb8 G A 18: 37,763,527 R550Q probably benign Het
Phldb3 T C 7: 24,624,152 L437P possibly damaging Het
Pianp C A 6: 125,001,602 P257T possibly damaging Het
Rbbp6 T A 7: 122,985,064 H140Q possibly damaging Het
Rfx2 A G 17: 56,780,804 I529T probably damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Rp1l1 T C 14: 64,031,150 I1395T possibly damaging Het
Rps6ka2 A C 17: 7,251,636 K186Q probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Rtel1 C A 2: 181,322,463 T85N probably benign Het
Rtn4rl2 T C 2: 84,880,623 N99S probably damaging Het
Ryr1 C T 7: 29,024,316 G4106D possibly damaging Het
Scgb2b24 A G 7: 33,738,469 V71A probably benign Het
Sgip1 A G 4: 102,921,028 probably benign Het
Slc12a4 G A 8: 105,949,739 T515I probably damaging Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Strbp C T 2: 37,625,216 R266Q probably damaging Het
Strn G T 17: 78,670,358 probably benign Het
Thnsl2 C A 6: 71,141,280 V55L probably benign Het
Tmem178b A T 6: 40,254,924 Q164L unknown Het
Tmprss6 C T 15: 78,440,257 R786H probably damaging Het
Ttc21a T A 9: 119,941,202 L113Q possibly damaging Het
Ttc21b T C 2: 66,208,650 probably null Het
Vmn2r51 T C 7: 10,098,264 D465G probably damaging Het
Vmp1 A C 11: 86,666,087 probably null Het
Wdcp T C 12: 4,851,358 F405L probably damaging Het
Zfhx3 A T 8: 108,949,517 T2400S probably benign Het
Zfp27 T C 7: 29,894,435 T702A probably benign Het
Zfp72 T C 13: 74,371,961 S333G probably benign Het
Other mutations in Ifrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Ifrd1 APN 12 40214093 missense probably benign 0.00
IGL02442:Ifrd1 APN 12 40216317 splice site probably benign
IGL02942:Ifrd1 APN 12 40217376 critical splice donor site probably null
IGL03119:Ifrd1 APN 12 40212334 missense probably null 0.03
R0107:Ifrd1 UTSW 12 40214081 missense probably damaging 1.00
R0138:Ifrd1 UTSW 12 40207130 splice site probably benign
R0390:Ifrd1 UTSW 12 40214094 splice site probably null
R0627:Ifrd1 UTSW 12 40206987 critical splice donor site probably null
R2061:Ifrd1 UTSW 12 40213245 missense probably benign 0.00
R5779:Ifrd1 UTSW 12 40203370 missense probably damaging 1.00
R5915:Ifrd1 UTSW 12 40213096 missense possibly damaging 0.94
R6000:Ifrd1 UTSW 12 40216244 missense possibly damaging 0.52
R6539:Ifrd1 UTSW 12 40203435 missense probably damaging 1.00
R6751:Ifrd1 UTSW 12 40203914 splice site probably null
R8117:Ifrd1 UTSW 12 40212351 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACACTTGGAGCTCAGCGAG -3'
(R):5'- GTGACTACCCGGGTGAATTC -3'

Sequencing Primer
(F):5'- CTTGGAGCTCAGCGAGGATCAG -3'
(R):5'- GACGAGGTCACGACGCAATC -3'
Posted On2018-09-12