Incidental Mutation 'R6800:Mia2'
ID533294
Institutional Source Beutler Lab
Gene Symbol Mia2
Ensembl Gene ENSMUSG00000021000
Gene Namemelanoma inhibitory activity 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R6800 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location59095799-59191583 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 59188546 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069430] [ENSMUST00000170992] [ENSMUST00000175877] [ENSMUST00000175912] [ENSMUST00000176322] [ENSMUST00000176336] [ENSMUST00000176464] [ENSMUST00000176752] [ENSMUST00000176892] [ENSMUST00000177162] [ENSMUST00000177225] [ENSMUST00000219140]
Predicted Effect probably null
Transcript: ENSMUST00000069430
SMART Domains Protein: ENSMUSP00000070572
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 124 253 9e-6 SMART
SCOP:d1fxkc_ 314 437 3e-16 SMART
low complexity region 480 493 N/A INTRINSIC
low complexity region 533 556 N/A INTRINSIC
low complexity region 682 700 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 751 775 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170992
SMART Domains Protein: ENSMUSP00000126538
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 102 231 2e-6 SMART
SCOP:d1fxkc_ 292 415 2e-17 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 660 678 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
low complexity region 700 720 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175837
SMART Domains Protein: ENSMUSP00000134828
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
SCOP:d1fxkc_ 3 90 5e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000175877
SMART Domains Protein: ENSMUSP00000135440
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d1fxkc_ 74 203 1e-5 SMART
SCOP:d1fxkc_ 264 387 6e-16 SMART
low complexity region 430 443 N/A INTRINSIC
low complexity region 589 607 N/A INTRINSIC
low complexity region 614 624 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
low complexity region 658 682 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000175912
SMART Domains Protein: ENSMUSP00000135251
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 115 244 8e-6 SMART
SCOP:d1fxkc_ 305 428 2e-16 SMART
low complexity region 471 484 N/A INTRINSIC
low complexity region 524 547 N/A INTRINSIC
low complexity region 673 691 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
low complexity region 713 733 N/A INTRINSIC
low complexity region 742 766 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176322
SMART Domains Protein: ENSMUSP00000135100
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 135 264 4e-6 SMART
SCOP:d1fxkc_ 325 448 9e-17 SMART
low complexity region 491 504 N/A INTRINSIC
low complexity region 544 567 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 718 728 N/A INTRINSIC
low complexity region 733 753 N/A INTRINSIC
low complexity region 762 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176336
SMART Domains Protein: ENSMUSP00000134872
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
coiled coil region 55 235 N/A INTRINSIC
SCOP:d1fxkc_ 281 404 6e-8 SMART
low complexity region 447 460 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176464
SMART Domains Protein: ENSMUSP00000135390
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 4e-6 SMART
SCOP:d1fxkc_ 316 439 8e-17 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 535 558 N/A INTRINSIC
low complexity region 684 702 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 753 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176617
Predicted Effect probably benign
Transcript: ENSMUST00000176752
SMART Domains Protein: ENSMUSP00000134972
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176892
SMART Domains Protein: ENSMUSP00000135245
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 91 220 4e-6 SMART
SCOP:d1fxkc_ 281 404 8e-17 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
low complexity region 649 667 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 718 742 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177162
SMART Domains Protein: ENSMUSP00000135001
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 2e-5 SMART
SCOP:d1fxkc_ 316 439 8e-16 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
low complexity region 666 676 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
low complexity region 710 734 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177225
SMART Domains Protein: ENSMUSP00000135618
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
SCOP:d1fxkc_ 98 227 3e-5 SMART
SCOP:d1fxkc_ 288 411 2e-15 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 613 631 N/A INTRINSIC
low complexity region 638 648 N/A INTRINSIC
low complexity region 653 673 N/A INTRINSIC
low complexity region 682 706 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000219140
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in endoplasmic reticulum-to-Golgi trafficking and regulation of cholesterol metabolism. Three major classes of transcripts are generated from this gene- melanoma inhibitory activity 2-specific transcripts, cTAGE family member 5-specific transcripts and transcripts that include exons from both these transcript species. Additionally, alternative splicing in these transcripts results in multiple transcript variants encoding diverse isoforms. A mutation in this gene (couch-potato or cpto) may result in low levels of plasma cholesterol and triglycerides. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit decreased serum levels of cholesterol, HDL cholesterol, triglyceride, and VLDL triglyceride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,288,279 F2091S probably benign Het
4930486L24Rik G A 13: 60,845,134 P244S probably damaging Het
9130023H24Rik C A 7: 128,237,570 probably benign Het
Acoxl A T 2: 128,010,165 Q129L probably damaging Het
Akna T C 4: 63,398,031 T32A probably benign Het
Alox15 C T 11: 70,344,819 probably null Het
Antxrl T C 14: 34,065,907 S296P probably damaging Het
Arrb2 G T 11: 70,437,316 G52* probably null Het
BC067074 T A 13: 113,368,152 D396E probably benign Het
Capn2 A T 1: 182,481,480 I499N probably damaging Het
Cubn T A 2: 13,321,255 I2700F probably damaging Het
Cypt4 A T 9: 24,625,669 N152Y probably benign Het
Dmxl2 T C 9: 54,409,183 N1640D probably damaging Het
Dnah7b A T 1: 46,340,217 N3704Y possibly damaging Het
Dnah9 A G 11: 66,072,739 probably null Het
Elac2 G A 11: 64,999,439 probably null Het
Erich3 A T 3: 154,727,392 probably null Het
Espnl T C 1: 91,342,629 V386A probably damaging Het
Fbxl6 T A 15: 76,538,698 probably benign Het
Fdps A C 3: 89,100,761 F17V probably damaging Het
Gigyf2 T C 1: 87,419,176 I576T possibly damaging Het
Gm20939 A G 17: 94,877,229 E435G possibly damaging Het
Gm4788 T A 1: 139,701,981 D683V possibly damaging Het
Hivep1 G A 13: 42,157,376 V1031I probably damaging Het
Hydin T G 8: 110,597,971 S4655A probably benign Het
Ifrd1 T A 12: 40,223,158 probably benign Het
Iqgap1 G T 7: 80,728,981 T1219K possibly damaging Het
Lmtk3 G A 7: 45,793,809 E639K possibly damaging Het
Map3k5 A G 10: 20,141,580 *1373W probably null Het
Micu2 T C 14: 57,919,439 D313G possibly damaging Het
Mrgpra4 A G 7: 47,981,623 S77P probably damaging Het
Mrpl51 T C 6: 125,192,404 V17A probably benign Het
Neurod4 A T 10: 130,270,792 Y204* probably null Het
Olfr134 A G 17: 38,175,122 I13V probably benign Het
Olfr492 G A 7: 108,323,253 T141I probably benign Het
Olfr682-ps1 A T 7: 105,127,010 V97E probably benign Het
Olfr792 A T 10: 129,541,263 H242L probably damaging Het
Pate2 T C 9: 35,685,645 probably benign Het
Pcdhgb8 G A 18: 37,763,527 R550Q probably benign Het
Phldb3 T C 7: 24,624,152 L437P possibly damaging Het
Pianp C A 6: 125,001,602 P257T possibly damaging Het
Rbbp6 T A 7: 122,985,064 H140Q possibly damaging Het
Rfx2 A G 17: 56,780,804 I529T probably damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Rp1l1 T C 14: 64,031,150 I1395T possibly damaging Het
Rps6ka2 A C 17: 7,251,636 K186Q probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Rtel1 C A 2: 181,322,463 T85N probably benign Het
Rtn4rl2 T C 2: 84,880,623 N99S probably damaging Het
Ryr1 C T 7: 29,024,316 G4106D possibly damaging Het
Scgb2b24 A G 7: 33,738,469 V71A probably benign Het
Sgip1 A G 4: 102,921,028 probably benign Het
Slc12a4 G A 8: 105,949,739 T515I probably damaging Het
Spag1 C T 15: 36,197,749 R286* probably null Het
Strbp C T 2: 37,625,216 R266Q probably damaging Het
Strn G T 17: 78,670,358 probably benign Het
Thnsl2 C A 6: 71,141,280 V55L probably benign Het
Tmem178b A T 6: 40,254,924 Q164L unknown Het
Tmprss6 C T 15: 78,440,257 R786H probably damaging Het
Ttc21a T A 9: 119,941,202 L113Q possibly damaging Het
Ttc21b T C 2: 66,208,650 probably null Het
Vmn2r51 T C 7: 10,098,264 D465G probably damaging Het
Vmp1 A C 11: 86,666,087 probably null Het
Wdcp T C 12: 4,851,358 F405L probably damaging Het
Zfhx3 A T 8: 108,949,517 T2400S probably benign Het
Zfp27 T C 7: 29,894,435 T702A probably benign Het
Zfp72 T C 13: 74,371,961 S333G probably benign Het
Other mutations in Mia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Mia2 APN 12 59160273 splice site probably benign
IGL00791:Mia2 APN 12 59108299 missense possibly damaging 0.82
IGL00821:Mia2 APN 12 59170320 critical splice donor site probably null
IGL00901:Mia2 APN 12 59108029 missense probably damaging 1.00
IGL00985:Mia2 APN 12 59188360 missense probably damaging 1.00
IGL01304:Mia2 APN 12 59104538 missense probably damaging 1.00
IGL01909:Mia2 APN 12 59107945 missense possibly damaging 0.94
IGL02646:Mia2 APN 12 59108836 missense probably damaging 1.00
IGL02800:Mia2 APN 12 59188491 nonsense probably null
IGL03332:Mia2 APN 12 59108398 missense probably damaging 0.97
PIT4812001:Mia2 UTSW 12 59101579 missense possibly damaging 0.92
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0449:Mia2 UTSW 12 59172594 critical splice donor site probably null
R0620:Mia2 UTSW 12 59154419 missense possibly damaging 0.96
R0622:Mia2 UTSW 12 59131578 missense probably damaging 0.98
R0632:Mia2 UTSW 12 59136143 missense probably damaging 0.99
R1643:Mia2 UTSW 12 59179845 splice site probably null
R1654:Mia2 UTSW 12 59108833 missense possibly damaging 0.92
R1706:Mia2 UTSW 12 59144766 nonsense probably null
R1776:Mia2 UTSW 12 59149575 splice site probably benign
R1848:Mia2 UTSW 12 59170251 splice site probably benign
R2240:Mia2 UTSW 12 59107882 missense probably benign 0.01
R2698:Mia2 UTSW 12 59170994 critical splice donor site probably null
R2860:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2861:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2862:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R3429:Mia2 UTSW 12 59189641 missense possibly damaging 0.89
R3861:Mia2 UTSW 12 59109021 missense probably benign 0.00
R3965:Mia2 UTSW 12 59176372 missense probably damaging 1.00
R5156:Mia2 UTSW 12 59172537 missense possibly damaging 0.94
R5249:Mia2 UTSW 12 59108125 missense probably damaging 0.99
R5330:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5331:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5815:Mia2 UTSW 12 59174106 missense possibly damaging 0.95
R5972:Mia2 UTSW 12 59146937 missense probably damaging 1.00
R6651:Mia2 UTSW 12 59154362 missense possibly damaging 0.78
R6676:Mia2 UTSW 12 59108370 missense probably damaging 0.97
R6695:Mia2 UTSW 12 59172580 missense probably damaging 0.99
R6845:Mia2 UTSW 12 59184278 nonsense probably null
R6919:Mia2 UTSW 12 59129895 missense possibly damaging 0.74
R7058:Mia2 UTSW 12 59184235 missense possibly damaging 0.77
R7209:Mia2 UTSW 12 59154390 missense possibly damaging 0.55
R7274:Mia2 UTSW 12 59108119 missense probably damaging 0.99
R7291:Mia2 UTSW 12 59158369 critical splice donor site probably null
R7874:Mia2 UTSW 12 59108588 missense probably damaging 0.99
R7894:Mia2 UTSW 12 59189647 missense probably damaging 1.00
R7961:Mia2 UTSW 12 59159639 critical splice donor site probably null
R7980:Mia2 UTSW 12 59108865 missense probably damaging 0.98
R8110:Mia2 UTSW 12 59109087 splice site probably null
X0063:Mia2 UTSW 12 59136139 missense probably damaging 0.99
Z1176:Mia2 UTSW 12 59108124 missense probably benign 0.27
Z1176:Mia2 UTSW 12 59108801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTATCCCTGCTGAATGCG -3'
(R):5'- GTGGTTTTCTGAACTATCACAATACAG -3'

Sequencing Primer
(F):5'- AGCTGGCCGTGGCTTCTTC -3'
(R):5'- TGAAAACTTAGCTAAGGTGGATGG -3'
Posted On2018-09-12