Incidental Mutation 'R6800:Spag1'
ID533302
Institutional Source Beutler Lab
Gene Symbol Spag1
Ensembl Gene ENSMUSG00000037617
Gene Namesperm associated antigen 1
Synonymstpis, TPR-containing protein involved in spermatogenesis
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.771) question?
Stock #R6800 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location36178099-36235621 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 36197749 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 286 (R286*)
Ref Sequence ENSEMBL: ENSMUSP00000132233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047348] [ENSMUST00000171205]
Predicted Effect probably null
Transcript: ENSMUST00000047348
AA Change: R286*
SMART Domains Protein: ENSMUSP00000047335
Gene: ENSMUSG00000037617
AA Change: R286*

DomainStartEndE-ValueType
TPR 213 246 1.88e0 SMART
TPR 247 279 3.47e-4 SMART
TPR 280 313 8.23e-6 SMART
low complexity region 383 400 N/A INTRINSIC
TPR 430 463 5.92e1 SMART
TPR 472 505 2.49e-5 SMART
TPR 506 539 5.31e0 SMART
TPR 606 639 7.63e-1 SMART
TPR 640 673 1.38e-7 SMART
Pfam:RPAP3_C 777 869 1.7e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171205
AA Change: R286*
SMART Domains Protein: ENSMUSP00000132233
Gene: ENSMUSG00000037617
AA Change: R286*

DomainStartEndE-ValueType
TPR 213 246 1.88e0 SMART
TPR 247 279 3.47e-4 SMART
TPR 280 313 8.23e-6 SMART
low complexity region 383 400 N/A INTRINSIC
TPR 430 463 5.92e1 SMART
TPR 472 505 2.49e-5 SMART
TPR 506 539 5.31e0 SMART
TPR 606 639 7.63e-1 SMART
TPR 640 673 1.38e-7 SMART
Pfam:RPAP3_C 777 869 1.7e-18 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm agglutinating antibodies from an infertile woman. Furthermore, immunization of female rats with the recombinant human protein reduced fertility. This protein localizes to the plasma membrane of germ cells in the testis and to the post-acrosomal plasma membrane of mature spermatozoa. Recombinant polypeptide binds GTP and exhibits GTPase activity. Thus, this protein may regulate GTP signal transduction pathways involved in spermatogenesis and fertilization. Two transcript variants of this gene encode the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,288,279 F2091S probably benign Het
4930486L24Rik G A 13: 60,845,134 P244S probably damaging Het
9130023H24Rik C A 7: 128,237,570 probably benign Het
Acoxl A T 2: 128,010,165 Q129L probably damaging Het
Akna T C 4: 63,398,031 T32A probably benign Het
Alox15 C T 11: 70,344,819 probably null Het
Antxrl T C 14: 34,065,907 S296P probably damaging Het
Arrb2 G T 11: 70,437,316 G52* probably null Het
BC067074 T A 13: 113,368,152 D396E probably benign Het
Capn2 A T 1: 182,481,480 I499N probably damaging Het
Cubn T A 2: 13,321,255 I2700F probably damaging Het
Cypt4 A T 9: 24,625,669 N152Y probably benign Het
Dmxl2 T C 9: 54,409,183 N1640D probably damaging Het
Dnah7b A T 1: 46,340,217 N3704Y possibly damaging Het
Dnah9 A G 11: 66,072,739 probably null Het
Elac2 G A 11: 64,999,439 probably null Het
Erich3 A T 3: 154,727,392 probably null Het
Espnl T C 1: 91,342,629 V386A probably damaging Het
Fbxl6 T A 15: 76,538,698 probably benign Het
Fdps A C 3: 89,100,761 F17V probably damaging Het
Gigyf2 T C 1: 87,419,176 I576T possibly damaging Het
Gm20939 A G 17: 94,877,229 E435G possibly damaging Het
Gm4788 T A 1: 139,701,981 D683V possibly damaging Het
Hivep1 G A 13: 42,157,376 V1031I probably damaging Het
Hydin T G 8: 110,597,971 S4655A probably benign Het
Ifrd1 T A 12: 40,223,158 probably benign Het
Iqgap1 G T 7: 80,728,981 T1219K possibly damaging Het
Lmtk3 G A 7: 45,793,809 E639K possibly damaging Het
Map3k5 A G 10: 20,141,580 *1373W probably null Het
Mia2 G A 12: 59,188,546 probably null Het
Micu2 T C 14: 57,919,439 D313G possibly damaging Het
Mrgpra4 A G 7: 47,981,623 S77P probably damaging Het
Mrpl51 T C 6: 125,192,404 V17A probably benign Het
Neurod4 A T 10: 130,270,792 Y204* probably null Het
Olfr134 A G 17: 38,175,122 I13V probably benign Het
Olfr492 G A 7: 108,323,253 T141I probably benign Het
Olfr682-ps1 A T 7: 105,127,010 V97E probably benign Het
Olfr792 A T 10: 129,541,263 H242L probably damaging Het
Pate2 T C 9: 35,685,645 probably benign Het
Pcdhgb8 G A 18: 37,763,527 R550Q probably benign Het
Phldb3 T C 7: 24,624,152 L437P possibly damaging Het
Pianp C A 6: 125,001,602 P257T possibly damaging Het
Rbbp6 T A 7: 122,985,064 H140Q possibly damaging Het
Rfx2 A G 17: 56,780,804 I529T probably damaging Het
Rnf113a1 A C X: 37,192,187 T266P probably benign Het
Rp1l1 T C 14: 64,031,150 I1395T possibly damaging Het
Rps6ka2 A C 17: 7,251,636 K186Q probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Rtel1 C A 2: 181,322,463 T85N probably benign Het
Rtn4rl2 T C 2: 84,880,623 N99S probably damaging Het
Ryr1 C T 7: 29,024,316 G4106D possibly damaging Het
Scgb2b24 A G 7: 33,738,469 V71A probably benign Het
Sgip1 A G 4: 102,921,028 probably benign Het
Slc12a4 G A 8: 105,949,739 T515I probably damaging Het
Strbp C T 2: 37,625,216 R266Q probably damaging Het
Strn G T 17: 78,670,358 probably benign Het
Thnsl2 C A 6: 71,141,280 V55L probably benign Het
Tmem178b A T 6: 40,254,924 Q164L unknown Het
Tmprss6 C T 15: 78,440,257 R786H probably damaging Het
Ttc21a T A 9: 119,941,202 L113Q possibly damaging Het
Ttc21b T C 2: 66,208,650 probably null Het
Vmn2r51 T C 7: 10,098,264 D465G probably damaging Het
Vmp1 A C 11: 86,666,087 probably null Het
Wdcp T C 12: 4,851,358 F405L probably damaging Het
Zfhx3 A T 8: 108,949,517 T2400S probably benign Het
Zfp27 T C 7: 29,894,435 T702A probably benign Het
Zfp72 T C 13: 74,371,961 S333G probably benign Het
Other mutations in Spag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Spag1 APN 15 36195416 nonsense probably null
IGL00465:Spag1 APN 15 36183821 unclassified probably benign
IGL00694:Spag1 APN 15 36227171 missense possibly damaging 0.94
IGL01479:Spag1 APN 15 36233199 splice site probably benign
IGL01830:Spag1 APN 15 36221559 missense probably benign 0.01
IGL02072:Spag1 APN 15 36190512 missense probably damaging 1.00
IGL02232:Spag1 APN 15 36221564 missense probably benign 0.00
IGL02727:Spag1 APN 15 36234818 missense probably damaging 1.00
IGL02810:Spag1 APN 15 36234547 missense probably damaging 1.00
IGL03010:Spag1 APN 15 36233273 missense probably benign 0.15
IGL03069:Spag1 APN 15 36224099 splice site probably benign
IGL03244:Spag1 APN 15 36234383 missense probably benign 0.00
FR4737:Spag1 UTSW 15 36197733 critical splice acceptor site probably benign
R0863:Spag1 UTSW 15 36192047 missense probably damaging 1.00
R1177:Spag1 UTSW 15 36234767 missense probably benign 0.21
R1878:Spag1 UTSW 15 36181770 missense probably damaging 1.00
R1879:Spag1 UTSW 15 36181770 missense probably damaging 1.00
R2086:Spag1 UTSW 15 36227141 missense probably damaging 0.98
R2093:Spag1 UTSW 15 36224130 missense probably damaging 1.00
R2231:Spag1 UTSW 15 36191167 missense probably benign 0.01
R4030:Spag1 UTSW 15 36234301 missense probably damaging 0.99
R4893:Spag1 UTSW 15 36197846 critical splice donor site probably null
R5047:Spag1 UTSW 15 36195442 missense probably damaging 1.00
R5505:Spag1 UTSW 15 36234626 missense probably damaging 0.99
R5741:Spag1 UTSW 15 36183703 missense possibly damaging 0.79
R5805:Spag1 UTSW 15 36200284 missense probably damaging 1.00
R6221:Spag1 UTSW 15 36197803 missense probably benign 0.30
R6236:Spag1 UTSW 15 36211135 missense probably damaging 1.00
R6556:Spag1 UTSW 15 36195407 missense probably damaging 1.00
R7737:Spag1 UTSW 15 36210710 missense probably benign 0.01
R8397:Spag1 UTSW 15 36197749 nonsense probably null
Z1177:Spag1 UTSW 15 36186676 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCGTGTATGTGCCATCAC -3'
(R):5'- GCAAGTTACTCAAAAGACTGAAGC -3'

Sequencing Primer
(F):5'- TGCCATCACACGGACCTG -3'
(R):5'- ATTCACTGCCAGTCTGGACTATAGG -3'
Posted On2018-09-12