Incidental Mutation 'R6801:Mybl1'
ID533312
Institutional Source Beutler Lab
Gene Symbol Mybl1
Ensembl Gene ENSMUSG00000025912
Gene Namemyeloblastosis oncogene-like 1
SynonymsA-myb, G1-419-6, repro9
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R6801 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location9667415-9700209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9683128 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 243 (V243A)
Ref Sequence ENSEMBL: ENSMUSP00000086034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088658] [ENSMUST00000115468]
Predicted Effect probably benign
Transcript: ENSMUST00000088658
AA Change: V243A

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000086034
Gene: ENSMUSG00000025912
AA Change: V243A

DomainStartEndE-ValueType
SANT 34 83 1.08e-18 SMART
SANT 86 135 1.26e-19 SMART
SANT 138 186 1.75e-18 SMART
Pfam:LMSTEN 240 285 1.2e-29 PFAM
Pfam:Cmyb_C 485 648 6.9e-82 PFAM
low complexity region 734 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115468
AA Change: V243A

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111128
Gene: ENSMUSG00000025912
AA Change: V243A

DomainStartEndE-ValueType
SANT 34 83 1.08e-18 SMART
SANT 86 135 1.26e-19 SMART
SANT 138 186 1.75e-18 SMART
Pfam:LMSTEN 239 285 1.9e-30 PFAM
Pfam:Cmyb_C 485 651 4.1e-74 PFAM
low complexity region 674 689 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Homozygous null mice of both sexes show growth retardation after birth and an impairment of serum antibody response. Male mutant mice are sterile due to a meiotic defect. While female mutant mice are fertile, breast development is impaired after pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,684,664 Y695F possibly damaging Het
Arhgap20 A G 9: 51,848,592 D545G probably damaging Het
Arhgef11 A G 3: 87,735,852 E1457G possibly damaging Het
Atp2b4 T A 1: 133,727,786 I747F probably damaging Het
Bche T A 3: 73,701,800 I98L probably benign Het
C2cd6 TC T 1: 59,094,583 probably null Het
Ccdc90b A G 7: 92,567,735 T72A probably benign Het
Chrd A G 16: 20,735,747 E352G possibly damaging Het
Csmd2 A G 4: 128,383,950 E953G probably benign Het
Dchs2 T A 3: 83,128,534 M196K probably benign Het
Ddx10 G A 9: 53,247,907 Q33* probably null Het
Dennd4b T A 3: 90,268,779 V201E probably damaging Het
Fbn2 T A 18: 58,113,348 H494L probably benign Het
Fbxw13 G A 9: 109,194,727 A83V probably null Het
Fxr1 A G 3: 34,054,303 D321G possibly damaging Het
Galm A G 17: 80,181,624 H233R probably benign Het
Gm7298 A G 6: 121,775,809 T837A probably benign Het
Gmppa C G 1: 75,441,747 S258C possibly damaging Het
Hk1 T G 10: 62,281,131 E645A probably damaging Het
Igkv1-132 A G 6: 67,760,340 T97A probably damaging Het
Kcnc1 T C 7: 46,435,292 F547L probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lingo2 T A 4: 35,709,566 E138V probably damaging Het
Myb T C 10: 21,144,966 probably null Het
Mylk4 C T 13: 32,728,410 S189N probably benign Het
Olfr1133 A G 2: 87,645,323 Y267H probably benign Het
Olfr1267-ps1 A T 2: 90,085,609 I284N probably damaging Het
Olfr1283 A T 2: 111,369,049 Q139L probably benign Het
Olfr1388 A G 11: 49,444,342 M164V probably benign Het
Olfr155 T A 4: 43,855,206 L299* probably null Het
Olfr27 A T 9: 39,144,210 I37F probably benign Het
Oxld1 A T 11: 120,456,824 D182E probably damaging Het
Phf13 A T 4: 151,991,560 L295Q probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prss33 A G 17: 23,834,839 L88P possibly damaging Het
Ralgds A G 2: 28,548,436 Y596C probably damaging Het
Rftn2 A G 1: 55,194,259 I379T possibly damaging Het
Rnf214 C T 9: 45,896,105 E267K probably damaging Het
Rpp14 T C 14: 8,083,717 probably benign Het
Rpusd2 A G 2: 119,035,395 Y191C probably damaging Het
Serpinb9c T A 13: 33,157,824 M1L probably benign Het
Shroom3 A G 5: 92,940,936 D434G probably damaging Het
Smc5 G A 19: 23,214,646 S888L probably benign Het
Suv39h2 C T 2: 3,464,421 R299K probably benign Het
Trappc4 A T 9: 44,404,388 I176N probably damaging Het
Trim12c A T 7: 104,348,130 V73E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Mybl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Mybl1 APN 1 9671679 missense probably damaging 1.00
IGL01431:Mybl1 APN 1 9672647 missense probably damaging 0.97
IGL01733:Mybl1 APN 1 9685710 missense possibly damaging 0.94
IGL01903:Mybl1 APN 1 9671576 splice site probably null
IGL02527:Mybl1 APN 1 9690148 missense probably damaging 0.99
IGL02729:Mybl1 APN 1 9672570 missense probably benign 0.22
IGL02810:Mybl1 APN 1 9673115 missense probably damaging 1.00
IGL02810:Mybl1 APN 1 9678388 missense probably benign
IGL03369:Mybl1 APN 1 9672555 missense probably damaging 0.99
R0696:Mybl1 UTSW 1 9673148 missense probably damaging 1.00
R1453:Mybl1 UTSW 1 9671676 missense probably benign 0.27
R1476:Mybl1 UTSW 1 9672661 splice site probably null
R1567:Mybl1 UTSW 1 9685751 missense probably damaging 1.00
R3110:Mybl1 UTSW 1 9681870 missense probably damaging 1.00
R3112:Mybl1 UTSW 1 9681870 missense probably damaging 1.00
R3438:Mybl1 UTSW 1 9687645 missense probably damaging 1.00
R3801:Mybl1 UTSW 1 9673214 missense probably damaging 1.00
R4333:Mybl1 UTSW 1 9672298 missense probably damaging 1.00
R4646:Mybl1 UTSW 1 9672286 missense probably damaging 1.00
R4705:Mybl1 UTSW 1 9690115 missense probably damaging 0.99
R5873:Mybl1 UTSW 1 9685665 missense possibly damaging 0.75
R6326:Mybl1 UTSW 1 9678507 critical splice acceptor site probably null
R6444:Mybl1 UTSW 1 9685692 missense possibly damaging 0.93
R7168:Mybl1 UTSW 1 9678288 missense probably damaging 1.00
R8322:Mybl1 UTSW 1 9676281 missense probably damaging 1.00
Z1176:Mybl1 UTSW 1 9685769 missense probably damaging 0.99
Z1177:Mybl1 UTSW 1 9676040 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCAGCAATGTTCTTTATCCTAGTT -3'
(R):5'- TGCTAGACAATATTCAGTCTCCAG -3'

Sequencing Primer
(F):5'- CTGGGATCACAGGTCTGTACATATC -3'
(R):5'- GGAGCTCAACATCTAGCCTTGAG -3'
Posted On2018-09-12