Incidental Mutation 'R6801:Prrc2c'
ID533317
Institutional Source Beutler Lab
Gene Symbol Prrc2c
Ensembl Gene ENSMUSG00000040225
Gene Nameproline-rich coiled-coil 2C
Synonyms9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R6801 (G1)
Quality Score217.468
Status Validated
Chromosome1
Chromosomal Location162670725-162740556 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TTGCTGCTGCTGCTGCTGCTGCTGCTGC to TTGCTGCTGCTGCTGCTGCTGCTGC at 162709061 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028016] [ENSMUST00000182149] [ENSMUST00000182393] [ENSMUST00000182593] [ENSMUST00000182660] [ENSMUST00000183011] [ENSMUST00000183223]
Predicted Effect probably benign
Transcript: ENSMUST00000028016
SMART Domains Protein: ENSMUSP00000028016
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
Pfam:BAT2_N 1 164 7.7e-56 PFAM
internal_repeat_2 167 349 4.39e-5 PROSPERO
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182149
SMART Domains Protein: ENSMUSP00000138548
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 5.6e-73 PFAM
internal_repeat_1 336 391 1.49e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
internal_repeat_3 754 925 9.16e-5 PROSPERO
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 1.49e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 3.08e-5 PROSPERO
internal_repeat_3 1983 2153 9.16e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182393
SMART Domains Protein: ENSMUSP00000138451
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
low complexity region 24 51 N/A INTRINSIC
low complexity region 104 125 N/A INTRINSIC
low complexity region 431 462 N/A INTRINSIC
low complexity region 481 519 N/A INTRINSIC
low complexity region 531 548 N/A INTRINSIC
low complexity region 560 625 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 946 968 N/A INTRINSIC
low complexity region 988 1002 N/A INTRINSIC
low complexity region 1037 1054 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
low complexity region 1274 1297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182448
Predicted Effect probably benign
Transcript: ENSMUST00000182593
SMART Domains Protein: ENSMUSP00000138674
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
Pfam:BAT2_N 1 165 4.1e-70 PFAM
internal_repeat_1 334 389 9.57e-6 PROSPERO
low complexity region 405 412 N/A INTRINSIC
SCOP:d1eq1a_ 445 589 3e-5 SMART
low complexity region 647 667 N/A INTRINSIC
low complexity region 731 743 N/A INTRINSIC
internal_repeat_3 752 923 6.11e-5 PROSPERO
coiled coil region 994 1024 N/A INTRINSIC
low complexity region 1155 1184 N/A INTRINSIC
low complexity region 1210 1220 N/A INTRINSIC
internal_repeat_1 1238 1293 9.57e-6 PROSPERO
low complexity region 1306 1333 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1713 1744 N/A INTRINSIC
low complexity region 1763 1801 N/A INTRINSIC
low complexity region 1813 1830 N/A INTRINSIC
low complexity region 1842 1907 N/A INTRINSIC
internal_repeat_2 1960 2146 2.01e-5 PROSPERO
internal_repeat_3 1981 2151 6.11e-5 PROSPERO
low complexity region 2161 2175 N/A INTRINSIC
low complexity region 2228 2250 N/A INTRINSIC
low complexity region 2270 2284 N/A INTRINSIC
low complexity region 2319 2336 N/A INTRINSIC
low complexity region 2425 2436 N/A INTRINSIC
low complexity region 2551 2574 N/A INTRINSIC
low complexity region 2671 2682 N/A INTRINSIC
low complexity region 2730 2747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182660
SMART Domains Protein: ENSMUSP00000138433
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 7e-73 PFAM
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183011
SMART Domains Protein: ENSMUSP00000138609
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
Pfam:BAT2_N 1 160 3.2e-64 PFAM
low complexity region 400 407 N/A INTRINSIC
coiled coil region 443 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183223
SMART Domains Protein: ENSMUSP00000138698
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
low complexity region 289 320 N/A INTRINSIC
low complexity region 339 377 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 418 483 N/A INTRINSIC
low complexity region 739 761 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
low complexity region 830 847 N/A INTRINSIC
low complexity region 936 947 N/A INTRINSIC
low complexity region 1062 1085 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1241 1258 N/A INTRINSIC
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,684,664 Y695F possibly damaging Het
Arhgap20 A G 9: 51,848,592 D545G probably damaging Het
Arhgef11 A G 3: 87,735,852 E1457G possibly damaging Het
Atp2b4 T A 1: 133,727,786 I747F probably damaging Het
Bche T A 3: 73,701,800 I98L probably benign Het
C2cd6 TC T 1: 59,094,583 probably null Het
Ccdc90b A G 7: 92,567,735 T72A probably benign Het
Chrd A G 16: 20,735,747 E352G possibly damaging Het
Csmd2 A G 4: 128,383,950 E953G probably benign Het
Dchs2 T A 3: 83,128,534 M196K probably benign Het
Ddx10 G A 9: 53,247,907 Q33* probably null Het
Dennd4b T A 3: 90,268,779 V201E probably damaging Het
Fbn2 T A 18: 58,113,348 H494L probably benign Het
Fbxw13 G A 9: 109,194,727 A83V probably null Het
Fxr1 A G 3: 34,054,303 D321G possibly damaging Het
Galm A G 17: 80,181,624 H233R probably benign Het
Gm7298 A G 6: 121,775,809 T837A probably benign Het
Gmppa C G 1: 75,441,747 S258C possibly damaging Het
Hk1 T G 10: 62,281,131 E645A probably damaging Het
Igkv1-132 A G 6: 67,760,340 T97A probably damaging Het
Kcnc1 T C 7: 46,435,292 F547L probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lingo2 T A 4: 35,709,566 E138V probably damaging Het
Myb T C 10: 21,144,966 probably null Het
Mybl1 A G 1: 9,683,128 V243A probably benign Het
Mylk4 C T 13: 32,728,410 S189N probably benign Het
Olfr1133 A G 2: 87,645,323 Y267H probably benign Het
Olfr1267-ps1 A T 2: 90,085,609 I284N probably damaging Het
Olfr1283 A T 2: 111,369,049 Q139L probably benign Het
Olfr1388 A G 11: 49,444,342 M164V probably benign Het
Olfr155 T A 4: 43,855,206 L299* probably null Het
Olfr27 A T 9: 39,144,210 I37F probably benign Het
Oxld1 A T 11: 120,456,824 D182E probably damaging Het
Phf13 A T 4: 151,991,560 L295Q probably damaging Het
Prss33 A G 17: 23,834,839 L88P possibly damaging Het
Ralgds A G 2: 28,548,436 Y596C probably damaging Het
Rftn2 A G 1: 55,194,259 I379T possibly damaging Het
Rnf214 C T 9: 45,896,105 E267K probably damaging Het
Rpp14 T C 14: 8,083,717 probably benign Het
Rpusd2 A G 2: 119,035,395 Y191C probably damaging Het
Serpinb9c T A 13: 33,157,824 M1L probably benign Het
Shroom3 A G 5: 92,940,936 D434G probably damaging Het
Smc5 G A 19: 23,214,646 S888L probably benign Het
Suv39h2 C T 2: 3,464,421 R299K probably benign Het
Trappc4 A T 9: 44,404,388 I176N probably damaging Het
Trim12c A T 7: 104,348,130 V73E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Prrc2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Prrc2c APN 1 162720613 splice site probably null
IGL00577:Prrc2c APN 1 162698116 missense unknown
IGL00580:Prrc2c APN 1 162698116 missense unknown
IGL01295:Prrc2c APN 1 162682492 missense probably damaging 1.00
IGL01554:Prrc2c APN 1 162710786 missense probably damaging 0.99
IGL01684:Prrc2c APN 1 162706462 unclassified probably benign
IGL01745:Prrc2c APN 1 162724728 missense probably damaging 1.00
IGL01770:Prrc2c APN 1 162704499 missense probably benign 0.23
IGL01905:Prrc2c APN 1 162705329 unclassified probably benign
IGL02304:Prrc2c APN 1 162684136 missense probably benign 0.05
IGL02389:Prrc2c APN 1 162692870 missense probably damaging 1.00
IGL02540:Prrc2c APN 1 162723137 missense probably damaging 1.00
IGL02681:Prrc2c APN 1 162705612 unclassified probably benign
IGL02686:Prrc2c APN 1 162707947 unclassified probably benign
IGL02795:Prrc2c APN 1 162714299 missense probably benign
IGL02894:Prrc2c APN 1 162678057 missense probably damaging 1.00
IGL02957:Prrc2c APN 1 162706535 unclassified probably benign
IGL02981:Prrc2c APN 1 162705179 unclassified probably benign
IGL03070:Prrc2c APN 1 162677409 missense probably damaging 1.00
IGL03096:Prrc2c APN 1 162702359 missense unknown
R0058:Prrc2c UTSW 1 162698884 missense unknown
R0058:Prrc2c UTSW 1 162698884 missense unknown
R0135:Prrc2c UTSW 1 162715483 splice site probably benign
R0279:Prrc2c UTSW 1 162715464 missense probably damaging 1.00
R0363:Prrc2c UTSW 1 162697811 missense unknown
R0436:Prrc2c UTSW 1 162705314 unclassified probably benign
R0605:Prrc2c UTSW 1 162682426 missense probably damaging 1.00
R0696:Prrc2c UTSW 1 162708852 critical splice donor site probably null
R0981:Prrc2c UTSW 1 162705981 unclassified probably benign
R1693:Prrc2c UTSW 1 162718713 missense probably damaging 0.98
R1714:Prrc2c UTSW 1 162677376 missense probably damaging 1.00
R1791:Prrc2c UTSW 1 162704982 unclassified probably benign
R1794:Prrc2c UTSW 1 162705959 unclassified probably benign
R1998:Prrc2c UTSW 1 162704918 unclassified probably benign
R2040:Prrc2c UTSW 1 162697557 missense probably damaging 1.00
R2168:Prrc2c UTSW 1 162710334 unclassified probably benign
R2246:Prrc2c UTSW 1 162707791 unclassified probably benign
R2830:Prrc2c UTSW 1 162708916 unclassified probably benign
R2926:Prrc2c UTSW 1 162706127 unclassified probably benign
R3703:Prrc2c UTSW 1 162710691 missense probably damaging 1.00
R3745:Prrc2c UTSW 1 162698185 missense unknown
R3760:Prrc2c UTSW 1 162692851 missense probably damaging 1.00
R3784:Prrc2c UTSW 1 162709669 unclassified probably benign
R3959:Prrc2c UTSW 1 162708892 unclassified probably benign
R4255:Prrc2c UTSW 1 162706326 unclassified probably benign
R4276:Prrc2c UTSW 1 162673591 missense probably damaging 1.00
R4421:Prrc2c UTSW 1 162709061 unclassified probably benign
R4593:Prrc2c UTSW 1 162697532 missense probably damaging 1.00
R4651:Prrc2c UTSW 1 162723274 missense probably damaging 1.00
R4652:Prrc2c UTSW 1 162723274 missense probably damaging 1.00
R4660:Prrc2c UTSW 1 162680895 missense probably damaging 1.00
R4677:Prrc2c UTSW 1 162705179 unclassified probably benign
R4688:Prrc2c UTSW 1 162697687 missense unknown
R4753:Prrc2c UTSW 1 162691230 missense probably damaging 1.00
R4790:Prrc2c UTSW 1 162710481 missense unknown
R4981:Prrc2c UTSW 1 162692547 missense probably damaging 1.00
R4995:Prrc2c UTSW 1 162705310 unclassified probably benign
R5119:Prrc2c UTSW 1 162705440 unclassified probably benign
R5127:Prrc2c UTSW 1 162697846 missense unknown
R5291:Prrc2c UTSW 1 162705582 unclassified probably benign
R5474:Prrc2c UTSW 1 162709644 unclassified probably benign
R5543:Prrc2c UTSW 1 162673511 missense probably damaging 0.99
R5579:Prrc2c UTSW 1 162680758 critical splice donor site probably null
R5594:Prrc2c UTSW 1 162699031 missense unknown
R5620:Prrc2c UTSW 1 162673529 missense probably damaging 1.00
R5994:Prrc2c UTSW 1 162674156 splice site probably null
R6142:Prrc2c UTSW 1 162710387 missense unknown
R6199:Prrc2c UTSW 1 162682516 missense probably damaging 1.00
R6277:Prrc2c UTSW 1 162714314 missense probably benign
R6504:Prrc2c UTSW 1 162697795 missense unknown
R6671:Prrc2c UTSW 1 162697585 missense probably damaging 1.00
R6785:Prrc2c UTSW 1 162709101 unclassified probably benign
R6799:Prrc2c UTSW 1 162709061 unclassified probably benign
R6850:Prrc2c UTSW 1 162709061 unclassified probably benign
R6851:Prrc2c UTSW 1 162709061 unclassified probably benign
R6856:Prrc2c UTSW 1 162682371 missense probably damaging 1.00
R6869:Prrc2c UTSW 1 162709061 unclassified probably benign
R6882:Prrc2c UTSW 1 162709061 unclassified probably benign
R6884:Prrc2c UTSW 1 162709061 unclassified probably benign
R6897:Prrc2c UTSW 1 162705506 unclassified probably benign
R6934:Prrc2c UTSW 1 162720505 missense probably benign 0.10
R6976:Prrc2c UTSW 1 162692844 missense probably damaging 1.00
R7132:Prrc2c UTSW 1 162681281 missense possibly damaging 0.77
R7165:Prrc2c UTSW 1 162673517 missense possibly damaging 0.94
R7282:Prrc2c UTSW 1 162679974 missense possibly damaging 0.59
R7467:Prrc2c UTSW 1 162677363 missense possibly damaging 0.84
X0020:Prrc2c UTSW 1 162707847 unclassified probably benign
X0039:Prrc2c UTSW 1 162704793 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCAAGTAGTAACAGTCACTCC -3'
(R):5'- TTGCCAACTCTGTGCTGATTG -3'

Sequencing Primer
(F):5'- TGGAATGTCCATAGCAGGCCTTC -3'
(R):5'- CAACTCTGTGCTGATTGTTTTTATC -3'
Posted On2018-09-12