Incidental Mutation 'R6801:Fxr1'
ID533326
Institutional Source Beutler Lab
Gene Symbol Fxr1
Ensembl Gene ENSMUSG00000027680
Gene Namefragile X mental retardation gene 1, autosomal homolog
Synonyms9530073J07Rik, Fxr1p, Fxr1h, 1110050J02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6801 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location34019943-34070322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34054303 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 321 (D321G)
Ref Sequence ENSEMBL: ENSMUSP00000001620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001620] [ENSMUST00000011029] [ENSMUST00000167354] [ENSMUST00000197694] [ENSMUST00000198051] [ENSMUST00000200086] [ENSMUST00000200392]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001620
AA Change: D321G

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001620
Gene: ENSMUSG00000027680
AA Change: D321G

DomainStartEndE-ValueType
Pfam:Agenet 2 55 4.4e-7 PFAM
Pfam:Agenet 62 120 7.1e-10 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
low complexity region 404 421 N/A INTRINSIC
Pfam:FXR_C1 489 564 1.9e-41 PFAM
low complexity region 572 582 N/A INTRINSIC
Pfam:FXR_C3 610 676 1.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000011029
SMART Domains Protein: ENSMUSP00000011029
Gene: ENSMUSG00000027679

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
DnaJ 61 101 1.31e-1 SMART
low complexity region 106 124 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167354
AA Change: D236G

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130216
Gene: ENSMUSG00000027680
AA Change: D236G

DomainStartEndE-ValueType
Pfam:Agenet 59 120 3.3e-14 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
Pfam:FXR1P_C 361 380 4.2e-9 PFAM
Pfam:FXR1P_C 379 486 1.5e-41 PFAM
low complexity region 502 510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197694
AA Change: D321G

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142441
Gene: ENSMUSG00000027680
AA Change: D321G

DomainStartEndE-ValueType
Pfam:Agenet 59 120 3.9e-14 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
Pfam:FXR1P_C 361 380 5e-9 PFAM
Pfam:FXR1P_C 379 486 1.8e-41 PFAM
low complexity region 502 510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198051
AA Change: D321G

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142847
Gene: ENSMUSG00000027680
AA Change: D321G

DomainStartEndE-ValueType
Pfam:Agenet 59 120 1.2e-11 PFAM
KH 217 284 2.2e-6 SMART
KH 286 356 7.5e-5 SMART
Pfam:FXR1P_C 361 515 1.6e-64 PFAM
low complexity region 531 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200086
SMART Domains Protein: ENSMUSP00000143562
Gene: ENSMUSG00000027680

DomainStartEndE-ValueType
PDB:3O8V|A 2 40 1e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000200392
AA Change: D321G

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143392
Gene: ENSMUSG00000027680
AA Change: D321G

DomainStartEndE-ValueType
Pfam:Agenet 59 120 3.3e-14 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
Pfam:FXR1P_C 361 380 4.2e-9 PFAM
Pfam:FXR1P_C 379 486 1.5e-41 PFAM
low complexity region 502 510 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA binding protein that interacts with the functionally-similar proteins FMR1 and FXR2. These proteins shuttle between the nucleus and cytoplasm and associate with polyribosomes, predominantly with the 60S ribosomal subunit. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality with impaired muscle development. Mice homozygous for a hypomorphic allele display a reduced life span with impaired muscle development, growth retardation, and reduced grip strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,684,664 Y695F possibly damaging Het
Arhgap20 A G 9: 51,848,592 D545G probably damaging Het
Arhgef11 A G 3: 87,735,852 E1457G possibly damaging Het
Atp2b4 T A 1: 133,727,786 I747F probably damaging Het
Bche T A 3: 73,701,800 I98L probably benign Het
C2cd6 TC T 1: 59,094,583 probably null Het
Ccdc90b A G 7: 92,567,735 T72A probably benign Het
Chrd A G 16: 20,735,747 E352G possibly damaging Het
Csmd2 A G 4: 128,383,950 E953G probably benign Het
Dchs2 T A 3: 83,128,534 M196K probably benign Het
Ddx10 G A 9: 53,247,907 Q33* probably null Het
Dennd4b T A 3: 90,268,779 V201E probably damaging Het
Fbn2 T A 18: 58,113,348 H494L probably benign Het
Fbxw13 G A 9: 109,194,727 A83V probably null Het
Galm A G 17: 80,181,624 H233R probably benign Het
Gm7298 A G 6: 121,775,809 T837A probably benign Het
Gmppa C G 1: 75,441,747 S258C possibly damaging Het
Hk1 T G 10: 62,281,131 E645A probably damaging Het
Igkv1-132 A G 6: 67,760,340 T97A probably damaging Het
Kcnc1 T C 7: 46,435,292 F547L probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lingo2 T A 4: 35,709,566 E138V probably damaging Het
Myb T C 10: 21,144,966 probably null Het
Mybl1 A G 1: 9,683,128 V243A probably benign Het
Mylk4 C T 13: 32,728,410 S189N probably benign Het
Olfr1133 A G 2: 87,645,323 Y267H probably benign Het
Olfr1267-ps1 A T 2: 90,085,609 I284N probably damaging Het
Olfr1283 A T 2: 111,369,049 Q139L probably benign Het
Olfr1388 A G 11: 49,444,342 M164V probably benign Het
Olfr155 T A 4: 43,855,206 L299* probably null Het
Olfr27 A T 9: 39,144,210 I37F probably benign Het
Oxld1 A T 11: 120,456,824 D182E probably damaging Het
Phf13 A T 4: 151,991,560 L295Q probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prss33 A G 17: 23,834,839 L88P possibly damaging Het
Ralgds A G 2: 28,548,436 Y596C probably damaging Het
Rftn2 A G 1: 55,194,259 I379T possibly damaging Het
Rnf214 C T 9: 45,896,105 E267K probably damaging Het
Rpp14 T C 14: 8,083,717 probably benign Het
Rpusd2 A G 2: 119,035,395 Y191C probably damaging Het
Serpinb9c T A 13: 33,157,824 M1L probably benign Het
Shroom3 A G 5: 92,940,936 D434G probably damaging Het
Smc5 G A 19: 23,214,646 S888L probably benign Het
Suv39h2 C T 2: 3,464,421 R299K probably benign Het
Trappc4 A T 9: 44,404,388 I176N probably damaging Het
Trim12c A T 7: 104,348,130 V73E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Fxr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Fxr1 APN 3 34047627 splice site probably benign
IGL01598:Fxr1 APN 3 34064232 missense possibly damaging 0.61
Outer_limits UTSW 3 34039543 missense probably benign 0.30
pueblo UTSW 3 34064232 missense possibly damaging 0.61
R4877_Fxr1_968 UTSW 3 34047698 missense probably damaging 0.99
R1294:Fxr1 UTSW 3 34047052 missense probably benign 0.00
R2134:Fxr1 UTSW 3 34058047 missense probably damaging 1.00
R2405:Fxr1 UTSW 3 34061854 missense probably damaging 1.00
R3023:Fxr1 UTSW 3 34064224 missense probably damaging 1.00
R3055:Fxr1 UTSW 3 34049184 missense probably damaging 1.00
R3056:Fxr1 UTSW 3 34049184 missense probably damaging 1.00
R4009:Fxr1 UTSW 3 34065022 missense probably benign 0.31
R4010:Fxr1 UTSW 3 34065022 missense probably benign 0.31
R4706:Fxr1 UTSW 3 34064129 missense probably damaging 0.99
R4721:Fxr1 UTSW 3 34064232 missense possibly damaging 0.61
R4877:Fxr1 UTSW 3 34047698 missense probably damaging 0.99
R5583:Fxr1 UTSW 3 34068976 missense probably benign 0.18
R6280:Fxr1 UTSW 3 34046252 intron probably benign
R7203:Fxr1 UTSW 3 34046540 missense possibly damaging 0.76
R7422:Fxr1 UTSW 3 34049220 missense probably damaging 1.00
R7523:Fxr1 UTSW 3 34039543 missense probably benign 0.30
R7785:Fxr1 UTSW 3 34046254 missense
R8195:Fxr1 UTSW 3 34047729 missense probably damaging 1.00
R8250:Fxr1 UTSW 3 34047029 nonsense probably null
R8809:Fxr1 UTSW 3 34054281 missense possibly damaging 0.75
X0067:Fxr1 UTSW 3 34046044 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CAATCATCTTTGCTTGGTGGTTATC -3'
(R):5'- AGACCGACTTTCCAAGAGTTAG -3'

Sequencing Primer
(F):5'- CATCTTTGCTTGGTGGTTATCATTTG -3'
(R):5'- CCGACTTTCCAAGAGTTAGCAAATTC -3'
Posted On2018-09-12