Incidental Mutation 'R6801:Adam3'
ID533341
Institutional Source Beutler Lab
Gene Symbol Adam3
Ensembl Gene ENSMUSG00000031553
Gene Namea disintegrin and metallopeptidase domain 3 (cyritestin)
SynonymsADAM3, Taz83, Taz83, Cyrn1, tMDC
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6801 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location24677225-24725852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24684664 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 695 (Y695F)
Ref Sequence ENSEMBL: ENSMUSP00000132651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033958] [ENSMUST00000167431] [ENSMUST00000170318] [ENSMUST00000171438]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033958
AA Change: Y695F

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033958
Gene: ENSMUSG00000031553
AA Change: Y695F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 144 3.8e-30 PFAM
Pfam:Reprolysin_5 185 361 6.8e-9 PFAM
Pfam:Reprolysin 187 384 1.6e-64 PFAM
Pfam:Reprolysin_3 211 333 1.2e-8 PFAM
DISIN 404 482 5.58e-32 SMART
ACR 483 614 4.1e-50 SMART
EGF 622 653 1.66e1 SMART
transmembrane domain 689 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167431
SMART Domains Protein: ENSMUSP00000127479
Gene: ENSMUSG00000031553

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170318
SMART Domains Protein: ENSMUSP00000132620
Gene: ENSMUSG00000031553

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 118 1.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171438
AA Change: Y695F

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132651
Gene: ENSMUSG00000031553
AA Change: Y695F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 23 144 2.4e-22 PFAM
Pfam:Reprolysin_5 185 361 7.8e-9 PFAM
Pfam:Reprolysin 187 384 4.1e-64 PFAM
Pfam:Reprolysin_3 211 321 1e-8 PFAM
DISIN 404 482 5.58e-32 SMART
ACR 483 614 4.1e-50 SMART
EGF 622 653 1.66e1 SMART
transmembrane domain 689 709 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are male infertile, due to the inability of the sperm to bind to the zona pellucida. If the zona pellucida is removed sperm-egg membrane fusion happens as expected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap20 A G 9: 51,848,592 D545G probably damaging Het
Arhgef11 A G 3: 87,735,852 E1457G possibly damaging Het
Atp2b4 T A 1: 133,727,786 I747F probably damaging Het
Bche T A 3: 73,701,800 I98L probably benign Het
C2cd6 TC T 1: 59,094,583 probably null Het
Ccdc90b A G 7: 92,567,735 T72A probably benign Het
Chrd A G 16: 20,735,747 E352G possibly damaging Het
Csmd2 A G 4: 128,383,950 E953G probably benign Het
Dchs2 T A 3: 83,128,534 M196K probably benign Het
Ddx10 G A 9: 53,247,907 Q33* probably null Het
Dennd4b T A 3: 90,268,779 V201E probably damaging Het
Fbn2 T A 18: 58,113,348 H494L probably benign Het
Fbxw13 G A 9: 109,194,727 A83V probably null Het
Fxr1 A G 3: 34,054,303 D321G possibly damaging Het
Galm A G 17: 80,181,624 H233R probably benign Het
Gm7298 A G 6: 121,775,809 T837A probably benign Het
Gmppa C G 1: 75,441,747 S258C possibly damaging Het
Hk1 T G 10: 62,281,131 E645A probably damaging Het
Igkv1-132 A G 6: 67,760,340 T97A probably damaging Het
Kcnc1 T C 7: 46,435,292 F547L probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lingo2 T A 4: 35,709,566 E138V probably damaging Het
Myb T C 10: 21,144,966 probably null Het
Mybl1 A G 1: 9,683,128 V243A probably benign Het
Mylk4 C T 13: 32,728,410 S189N probably benign Het
Olfr1133 A G 2: 87,645,323 Y267H probably benign Het
Olfr1267-ps1 A T 2: 90,085,609 I284N probably damaging Het
Olfr1283 A T 2: 111,369,049 Q139L probably benign Het
Olfr1388 A G 11: 49,444,342 M164V probably benign Het
Olfr155 T A 4: 43,855,206 L299* probably null Het
Olfr27 A T 9: 39,144,210 I37F probably benign Het
Oxld1 A T 11: 120,456,824 D182E probably damaging Het
Phf13 A T 4: 151,991,560 L295Q probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prss33 A G 17: 23,834,839 L88P possibly damaging Het
Ralgds A G 2: 28,548,436 Y596C probably damaging Het
Rftn2 A G 1: 55,194,259 I379T possibly damaging Het
Rnf214 C T 9: 45,896,105 E267K probably damaging Het
Rpp14 T C 14: 8,083,717 probably benign Het
Rpusd2 A G 2: 119,035,395 Y191C probably damaging Het
Serpinb9c T A 13: 33,157,824 M1L probably benign Het
Shroom3 A G 5: 92,940,936 D434G probably damaging Het
Smc5 G A 19: 23,214,646 S888L probably benign Het
Suv39h2 C T 2: 3,464,421 R299K probably benign Het
Trappc4 A T 9: 44,404,388 I176N probably damaging Het
Trim12c A T 7: 104,348,130 V73E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Adam3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Adam3 APN 8 24694278 missense probably damaging 1.00
IGL01792:Adam3 APN 8 24697203 missense probably benign 0.27
IGL01894:Adam3 APN 8 24687938 missense probably benign 0.33
IGL01941:Adam3 APN 8 24681446 utr 3 prime probably benign
IGL02355:Adam3 APN 8 24697191 missense probably damaging 1.00
IGL02362:Adam3 APN 8 24697191 missense probably damaging 1.00
IGL02511:Adam3 APN 8 24695176 missense probably damaging 0.98
IGL03070:Adam3 APN 8 24703784 missense probably damaging 1.00
IGL03106:Adam3 APN 8 24715119 splice site probably benign
IGL03238:Adam3 APN 8 24687965 splice site probably null
I2288:Adam3 UTSW 8 24684661 missense probably damaging 1.00
R0511:Adam3 UTSW 8 24695315 missense probably damaging 1.00
R1103:Adam3 UTSW 8 24714271 splice site probably benign
R1104:Adam3 UTSW 8 24681529 missense probably benign 0.10
R1430:Adam3 UTSW 8 24714271 splice site probably benign
R1599:Adam3 UTSW 8 24725361 missense possibly damaging 0.50
R1663:Adam3 UTSW 8 24687933 missense probably benign 0.03
R2023:Adam3 UTSW 8 24689463 missense possibly damaging 0.93
R2278:Adam3 UTSW 8 24711384 missense probably damaging 0.99
R3033:Adam3 UTSW 8 24694211 missense probably benign 0.00
R3440:Adam3 UTSW 8 24680743 utr 3 prime probably benign
R3441:Adam3 UTSW 8 24680743 utr 3 prime probably benign
R3688:Adam3 UTSW 8 24703848 missense probably benign 0.02
R4478:Adam3 UTSW 8 24695155 missense probably benign 0.04
R4654:Adam3 UTSW 8 24703803 missense probably damaging 1.00
R4811:Adam3 UTSW 8 24711724 missense probably benign 0.10
R4910:Adam3 UTSW 8 24694305 missense probably benign 0.03
R4921:Adam3 UTSW 8 24684614 missense probably benign 0.01
R4941:Adam3 UTSW 8 24677316 unclassified probably benign
R5239:Adam3 UTSW 8 24694191 missense possibly damaging 0.62
R5771:Adam3 UTSW 8 24707411 missense probably benign 0.00
R5897:Adam3 UTSW 8 24697228 missense probably benign 0.00
R5916:Adam3 UTSW 8 24684539 critical splice donor site probably null
R5979:Adam3 UTSW 8 24677367 missense probably benign 0.03
R6168:Adam3 UTSW 8 24681614 splice site probably null
R6189:Adam3 UTSW 8 24711336 missense probably benign 0.01
R6997:Adam3 UTSW 8 24681523 missense probably benign 0.10
R7065:Adam3 UTSW 8 24711675 critical splice donor site probably null
R7074:Adam3 UTSW 8 24694347 missense probably benign 0.01
R7151:Adam3 UTSW 8 24695255 missense probably damaging 1.00
R7208:Adam3 UTSW 8 24711401 missense probably damaging 0.98
R7341:Adam3 UTSW 8 24687980 missense possibly damaging 0.60
R7528:Adam3 UTSW 8 24677263 missense unknown
R7797:Adam3 UTSW 8 24694644 missense probably damaging 1.00
R7891:Adam3 UTSW 8 24707497 critical splice acceptor site probably null
R8064:Adam3 UTSW 8 24681550 missense probably benign 0.10
R8157:Adam3 UTSW 8 24707437 missense probably benign 0.27
R8229:Adam3 UTSW 8 24711738 missense probably damaging 0.98
X0063:Adam3 UTSW 8 24711706 missense probably damaging 0.96
Z1088:Adam3 UTSW 8 24681431 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- CAGTTTGTCCAAGCAACCATC -3'
(R):5'- GAAACCGAGACGTCACTGTG -3'

Sequencing Primer
(F):5'- ACTTAACCGTGTTCAAATACTTCCTG -3'
(R):5'- ACGTCACTGTGGGCAAAAC -3'
Posted On2018-09-12