Incidental Mutation 'R6801:Fbxw13'
ID533347
Institutional Source Beutler Lab
Gene Symbol Fbxw13
Ensembl Gene ENSMUSG00000049314
Gene NameF-box and WD-40 domain protein 13
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6801 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109179227-109195975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109194727 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 83 (A83V)
Ref Sequence ENSEMBL: ENSMUSP00000053786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061456] [ENSMUST00000199102] [ENSMUST00000199118]
Predicted Effect probably null
Transcript: ENSMUST00000061456
AA Change: A83V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053786
Gene: ENSMUSG00000049314
AA Change: A83V

DomainStartEndE-ValueType
FBOX 5 45 9.33e-5 SMART
SCOP:d1gxra_ 128 249 8e-7 SMART
Blast:WD40 137 176 2e-7 BLAST
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199102
SMART Domains Protein: ENSMUSP00000142352
Gene: ENSMUSG00000049314

DomainStartEndE-ValueType
SCOP:d1gxra_ 45 166 1e-7 SMART
Blast:WD40 54 93 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199118
SMART Domains Protein: ENSMUSP00000143174
Gene: ENSMUSG00000049314

DomainStartEndE-ValueType
FBOX 5 45 3.25e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,684,664 Y695F possibly damaging Het
Arhgap20 A G 9: 51,848,592 D545G probably damaging Het
Arhgef11 A G 3: 87,735,852 E1457G possibly damaging Het
Atp2b4 T A 1: 133,727,786 I747F probably damaging Het
Bche T A 3: 73,701,800 I98L probably benign Het
C2cd6 TC T 1: 59,094,583 probably null Het
Ccdc90b A G 7: 92,567,735 T72A probably benign Het
Chrd A G 16: 20,735,747 E352G possibly damaging Het
Csmd2 A G 4: 128,383,950 E953G probably benign Het
Dchs2 T A 3: 83,128,534 M196K probably benign Het
Ddx10 G A 9: 53,247,907 Q33* probably null Het
Dennd4b T A 3: 90,268,779 V201E probably damaging Het
Fbn2 T A 18: 58,113,348 H494L probably benign Het
Fxr1 A G 3: 34,054,303 D321G possibly damaging Het
Galm A G 17: 80,181,624 H233R probably benign Het
Gm7298 A G 6: 121,775,809 T837A probably benign Het
Gmppa C G 1: 75,441,747 S258C possibly damaging Het
Hk1 T G 10: 62,281,131 E645A probably damaging Het
Igkv1-132 A G 6: 67,760,340 T97A probably damaging Het
Kcnc1 T C 7: 46,435,292 F547L probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lingo2 T A 4: 35,709,566 E138V probably damaging Het
Myb T C 10: 21,144,966 probably null Het
Mybl1 A G 1: 9,683,128 V243A probably benign Het
Mylk4 C T 13: 32,728,410 S189N probably benign Het
Olfr1133 A G 2: 87,645,323 Y267H probably benign Het
Olfr1267-ps1 A T 2: 90,085,609 I284N probably damaging Het
Olfr1283 A T 2: 111,369,049 Q139L probably benign Het
Olfr1388 A G 11: 49,444,342 M164V probably benign Het
Olfr155 T A 4: 43,855,206 L299* probably null Het
Olfr27 A T 9: 39,144,210 I37F probably benign Het
Oxld1 A T 11: 120,456,824 D182E probably damaging Het
Phf13 A T 4: 151,991,560 L295Q probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prss33 A G 17: 23,834,839 L88P possibly damaging Het
Ralgds A G 2: 28,548,436 Y596C probably damaging Het
Rftn2 A G 1: 55,194,259 I379T possibly damaging Het
Rnf214 C T 9: 45,896,105 E267K probably damaging Het
Rpp14 T C 14: 8,083,717 probably benign Het
Rpusd2 A G 2: 119,035,395 Y191C probably damaging Het
Serpinb9c T A 13: 33,157,824 M1L probably benign Het
Shroom3 A G 5: 92,940,936 D434G probably damaging Het
Smc5 G A 19: 23,214,646 S888L probably benign Het
Suv39h2 C T 2: 3,464,421 R299K probably benign Het
Trappc4 A T 9: 44,404,388 I176N probably damaging Het
Trim12c A T 7: 104,348,130 V73E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Fbxw13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Fbxw13 APN 9 109181416 missense probably damaging 0.99
IGL02455:Fbxw13 APN 9 109183187 missense probably benign 0.26
IGL03154:Fbxw13 APN 9 109181465 missense probably damaging 0.96
R0304:Fbxw13 UTSW 9 109194721 missense probably benign 0.02
R1259:Fbxw13 UTSW 9 109185371 missense probably damaging 1.00
R1710:Fbxw13 UTSW 9 109181518 missense probably damaging 1.00
R1912:Fbxw13 UTSW 9 109181543 missense probably benign 0.10
R2877:Fbxw13 UTSW 9 109181466 missense probably damaging 1.00
R2878:Fbxw13 UTSW 9 109181466 missense probably damaging 1.00
R3085:Fbxw13 UTSW 9 109184231 nonsense probably null
R4321:Fbxw13 UTSW 9 109181435 missense probably benign 0.10
R4969:Fbxw13 UTSW 9 109181524 splice site probably null
R5024:Fbxw13 UTSW 9 109179335 missense probably benign 0.00
R5450:Fbxw13 UTSW 9 109184157 missense probably benign 0.41
R5957:Fbxw13 UTSW 9 109192666 critical splice donor site probably null
R7448:Fbxw13 UTSW 9 109185403 missense unknown
R7710:Fbxw13 UTSW 9 109195900 missense probably damaging 1.00
R8163:Fbxw13 UTSW 9 109183054 missense probably benign 0.45
R8320:Fbxw13 UTSW 9 109183066 missense probably benign 0.02
R8714:Fbxw13 UTSW 9 109194764 missense probably benign 0.00
R8845:Fbxw13 UTSW 9 109194765 missense possibly damaging 0.85
R8884:Fbxw13 UTSW 9 109181401 missense probably benign 0.00
X0065:Fbxw13 UTSW 9 109192708 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACAGATTGGTTCCATGGCTG -3'
(R):5'- TGCCACATGAAGATGGTTAGTG -3'

Sequencing Primer
(F):5'- AGATTGGTTCCATGGCTGTGCTAG -3'
(R):5'- CACTGTAACCATGGCTCTAAAGTGAG -3'
Posted On2018-09-12