Incidental Mutation 'R6801:Mylk4'
ID533351
Institutional Source Beutler Lab
Gene Symbol Mylk4
Ensembl Gene ENSMUSG00000044951
Gene Namemyosin light chain kinase family, member 4
SynonymsEG238564
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6801 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location32700834-32783954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32728410 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 189 (S189N)
Ref Sequence ENSEMBL: ENSMUSP00000155702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057428] [ENSMUST00000230119]
Predicted Effect probably benign
Transcript: ENSMUST00000057428
SMART Domains Protein: ENSMUSP00000060149
Gene: ENSMUSG00000044951

DomainStartEndE-ValueType
S_TKc 107 362 4.2e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230119
AA Change: S189N

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,684,664 Y695F possibly damaging Het
Arhgap20 A G 9: 51,848,592 D545G probably damaging Het
Arhgef11 A G 3: 87,735,852 E1457G possibly damaging Het
Atp2b4 T A 1: 133,727,786 I747F probably damaging Het
Bche T A 3: 73,701,800 I98L probably benign Het
C2cd6 TC T 1: 59,094,583 probably null Het
Ccdc90b A G 7: 92,567,735 T72A probably benign Het
Chrd A G 16: 20,735,747 E352G possibly damaging Het
Csmd2 A G 4: 128,383,950 E953G probably benign Het
Dchs2 T A 3: 83,128,534 M196K probably benign Het
Ddx10 G A 9: 53,247,907 Q33* probably null Het
Dennd4b T A 3: 90,268,779 V201E probably damaging Het
Fbn2 T A 18: 58,113,348 H494L probably benign Het
Fbxw13 G A 9: 109,194,727 A83V probably null Het
Fxr1 A G 3: 34,054,303 D321G possibly damaging Het
Galm A G 17: 80,181,624 H233R probably benign Het
Gm7298 A G 6: 121,775,809 T837A probably benign Het
Gmppa C G 1: 75,441,747 S258C possibly damaging Het
Hk1 T G 10: 62,281,131 E645A probably damaging Het
Igkv1-132 A G 6: 67,760,340 T97A probably damaging Het
Kcnc1 T C 7: 46,435,292 F547L probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lingo2 T A 4: 35,709,566 E138V probably damaging Het
Myb T C 10: 21,144,966 probably null Het
Mybl1 A G 1: 9,683,128 V243A probably benign Het
Olfr1133 A G 2: 87,645,323 Y267H probably benign Het
Olfr1267-ps1 A T 2: 90,085,609 I284N probably damaging Het
Olfr1283 A T 2: 111,369,049 Q139L probably benign Het
Olfr1388 A G 11: 49,444,342 M164V probably benign Het
Olfr155 T A 4: 43,855,206 L299* probably null Het
Olfr27 A T 9: 39,144,210 I37F probably benign Het
Oxld1 A T 11: 120,456,824 D182E probably damaging Het
Phf13 A T 4: 151,991,560 L295Q probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prss33 A G 17: 23,834,839 L88P possibly damaging Het
Ralgds A G 2: 28,548,436 Y596C probably damaging Het
Rftn2 A G 1: 55,194,259 I379T possibly damaging Het
Rnf214 C T 9: 45,896,105 E267K probably damaging Het
Rpp14 T C 14: 8,083,717 probably benign Het
Rpusd2 A G 2: 119,035,395 Y191C probably damaging Het
Serpinb9c T A 13: 33,157,824 M1L probably benign Het
Shroom3 A G 5: 92,940,936 D434G probably damaging Het
Smc5 G A 19: 23,214,646 S888L probably benign Het
Suv39h2 C T 2: 3,464,421 R299K probably benign Het
Trappc4 A T 9: 44,404,388 I176N probably damaging Het
Trim12c A T 7: 104,348,130 V73E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Mylk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Mylk4 APN 13 32715922 missense probably damaging 1.00
IGL01799:Mylk4 APN 13 32781691 missense probably benign 0.00
IGL01985:Mylk4 APN 13 32717581 missense possibly damaging 0.81
IGL02105:Mylk4 APN 13 32720562 missense probably benign 0.17
IGL02270:Mylk4 APN 13 32729066 splice site probably benign
IGL02377:Mylk4 APN 13 32722147 missense possibly damaging 0.69
IGL03142:Mylk4 APN 13 32720599 missense probably damaging 1.00
R0550:Mylk4 UTSW 13 32716666 missense probably benign 0.00
R0599:Mylk4 UTSW 13 32712754 splice site probably null
R1070:Mylk4 UTSW 13 32724818 missense probably benign 0.05
R1520:Mylk4 UTSW 13 32712838 splice site probably null
R1658:Mylk4 UTSW 13 32712789 missense possibly damaging 0.77
R1917:Mylk4 UTSW 13 32724853 missense probably benign 0.00
R1918:Mylk4 UTSW 13 32724853 missense probably benign 0.00
R1919:Mylk4 UTSW 13 32724853 missense probably benign 0.00
R2187:Mylk4 UTSW 13 32722013 missense probably damaging 0.97
R2568:Mylk4 UTSW 13 32722018 missense probably null 0.97
R4832:Mylk4 UTSW 13 32721977 missense probably benign 0.04
R5268:Mylk4 UTSW 13 32708881 splice site probably null
R6894:Mylk4 UTSW 13 32722015 missense probably damaging 1.00
R7302:Mylk4 UTSW 13 32720565 missense probably benign 0.39
R7329:Mylk4 UTSW 13 32716783 missense probably damaging 1.00
R7634:Mylk4 UTSW 13 32708908 missense possibly damaging 0.88
R7702:Mylk4 UTSW 13 32720602 critical splice acceptor site probably null
R7944:Mylk4 UTSW 13 32727113 missense probably benign 0.02
R8256:Mylk4 UTSW 13 32720539 missense probably damaging 1.00
R8777:Mylk4 UTSW 13 32729106 missense probably benign 0.00
R8777-TAIL:Mylk4 UTSW 13 32729106 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGAGCAGGTTCTAAACATTGC -3'
(R):5'- GTTCAGAGGAATTCCACAGAGC -3'

Sequencing Primer
(F):5'- AACATTGCCGTTAAAACTGTCTCC -3'
(R):5'- TTCCACAGAGCTAAGAGAGAATGC -3'
Posted On2018-09-12