Incidental Mutation 'R6801:Serpinb9c'
ID533352
Institutional Source Beutler Lab
Gene Symbol Serpinb9c
Ensembl Gene ENSMUSG00000021404
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9c
SynonymsNK9, Spi11, ovalbumin, 3830421J05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6801 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location33149275-33159742 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 33157824 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000116267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021837] [ENSMUST00000110284] [ENSMUST00000135897]
Predicted Effect probably benign
Transcript: ENSMUST00000021837
AA Change: M29L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021837
Gene: ENSMUSG00000021404
AA Change: M29L

DomainStartEndE-ValueType
SERPIN 24 387 2.85e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110284
AA Change: M1L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105913
Gene: ENSMUSG00000021404
AA Change: M1L

DomainStartEndE-ValueType
SERPIN 1 359 1.21e-146 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135897
AA Change: M1L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000116267
Gene: ENSMUSG00000021404
AA Change: M1L

DomainStartEndE-ValueType
Pfam:Serpin 1 88 7.2e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,684,664 Y695F possibly damaging Het
Arhgap20 A G 9: 51,848,592 D545G probably damaging Het
Arhgef11 A G 3: 87,735,852 E1457G possibly damaging Het
Atp2b4 T A 1: 133,727,786 I747F probably damaging Het
Bche T A 3: 73,701,800 I98L probably benign Het
C2cd6 TC T 1: 59,094,583 probably null Het
Ccdc90b A G 7: 92,567,735 T72A probably benign Het
Chrd A G 16: 20,735,747 E352G possibly damaging Het
Csmd2 A G 4: 128,383,950 E953G probably benign Het
Dchs2 T A 3: 83,128,534 M196K probably benign Het
Ddx10 G A 9: 53,247,907 Q33* probably null Het
Dennd4b T A 3: 90,268,779 V201E probably damaging Het
Fbn2 T A 18: 58,113,348 H494L probably benign Het
Fbxw13 G A 9: 109,194,727 A83V probably null Het
Fxr1 A G 3: 34,054,303 D321G possibly damaging Het
Galm A G 17: 80,181,624 H233R probably benign Het
Gm7298 A G 6: 121,775,809 T837A probably benign Het
Gmppa C G 1: 75,441,747 S258C possibly damaging Het
Hk1 T G 10: 62,281,131 E645A probably damaging Het
Igkv1-132 A G 6: 67,760,340 T97A probably damaging Het
Kcnc1 T C 7: 46,435,292 F547L probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lingo2 T A 4: 35,709,566 E138V probably damaging Het
Myb T C 10: 21,144,966 probably null Het
Mybl1 A G 1: 9,683,128 V243A probably benign Het
Mylk4 C T 13: 32,728,410 S189N probably benign Het
Olfr1133 A G 2: 87,645,323 Y267H probably benign Het
Olfr1267-ps1 A T 2: 90,085,609 I284N probably damaging Het
Olfr1283 A T 2: 111,369,049 Q139L probably benign Het
Olfr1388 A G 11: 49,444,342 M164V probably benign Het
Olfr155 T A 4: 43,855,206 L299* probably null Het
Olfr27 A T 9: 39,144,210 I37F probably benign Het
Oxld1 A T 11: 120,456,824 D182E probably damaging Het
Phf13 A T 4: 151,991,560 L295Q probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prss33 A G 17: 23,834,839 L88P possibly damaging Het
Ralgds A G 2: 28,548,436 Y596C probably damaging Het
Rftn2 A G 1: 55,194,259 I379T possibly damaging Het
Rnf214 C T 9: 45,896,105 E267K probably damaging Het
Rpp14 T C 14: 8,083,717 probably benign Het
Rpusd2 A G 2: 119,035,395 Y191C probably damaging Het
Shroom3 A G 5: 92,940,936 D434G probably damaging Het
Smc5 G A 19: 23,214,646 S888L probably benign Het
Suv39h2 C T 2: 3,464,421 R299K probably benign Het
Trappc4 A T 9: 44,404,388 I176N probably damaging Het
Trim12c A T 7: 104,348,130 V73E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Serpinb9c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Serpinb9c APN 13 33151884 missense probably damaging 0.98
IGL01357:Serpinb9c APN 13 33151879 missense probably benign 0.02
IGL01413:Serpinb9c APN 13 33151804 missense probably damaging 0.99
R1411:Serpinb9c UTSW 13 33151834 missense probably benign 0.02
R1926:Serpinb9c UTSW 13 33150235 missense probably benign 0.00
R2057:Serpinb9c UTSW 13 33156871 nonsense probably null
R2058:Serpinb9c UTSW 13 33156871 nonsense probably null
R2059:Serpinb9c UTSW 13 33156871 nonsense probably null
R2272:Serpinb9c UTSW 13 33154541 missense probably damaging 1.00
R3948:Serpinb9c UTSW 13 33150094 missense probably benign
R4520:Serpinb9c UTSW 13 33151857 splice site probably null
R4558:Serpinb9c UTSW 13 33154499 missense probably benign 0.12
R4735:Serpinb9c UTSW 13 33150271 missense probably benign 0.13
R5004:Serpinb9c UTSW 13 33150355 missense probably benign 0.00
R5009:Serpinb9c UTSW 13 33154431 missense probably benign 0.18
R6345:Serpinb9c UTSW 13 33149995 missense probably damaging 1.00
R6886:Serpinb9c UTSW 13 33150327 missense probably benign 0.04
R7082:Serpinb9c UTSW 13 33154407 missense probably benign 0.40
R7288:Serpinb9c UTSW 13 33151900 missense possibly damaging 0.66
R7988:Serpinb9c UTSW 13 33150279 missense probably benign 0.04
R8309:Serpinb9c UTSW 13 33150111 missense possibly damaging 0.70
R8465:Serpinb9c UTSW 13 33150033 missense probably damaging 1.00
R8543:Serpinb9c UTSW 13 33156434 missense probably damaging 1.00
R8750:Serpinb9c UTSW 13 33151810 missense probably null 0.93
Predicted Primers PCR Primer
(F):5'- CAACAGCTCTTATGCATGCG -3'
(R):5'- AGCTTTCCTTCTATATGTGCAGAG -3'

Sequencing Primer
(F):5'- CAGCTCTTATGCATGCGAAATAG -3'
(R):5'- TAGACCACCCTTCCTGAA -3'
Posted On2018-09-12