Incidental Mutation 'R6801:Galm'
ID533357
Institutional Source Beutler Lab
Gene Symbol Galm
Ensembl Gene ENSMUSG00000035473
Gene Namegalactose mutarotase
SynonymsA530057M15Rik, aldose 1-epimerase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6801 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location80127471-80185101 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80181624 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 233 (H233R)
Ref Sequence ENSEMBL: ENSMUSP00000040580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039205]
Predicted Effect probably benign
Transcript: ENSMUST00000039205
AA Change: H233R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000040580
Gene: ENSMUSG00000035473
AA Change: H233R

DomainStartEndE-ValueType
Pfam:Aldose_epim 20 338 7.1e-102 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000120018
Gene: ENSMUSG00000035473
AA Change: H60R

DomainStartEndE-ValueType
Pfam:Aldose_epim 1 159 6.1e-41 PFAM
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the epimerization of hexose sugars such as glucose and galactose. The encoded protein is expressed in the cytoplasm and has a preference for galactose. The encoded protein may be required for normal galactose metabolism by maintaining the equilibrium of alpha and beta anomers of galactose.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,684,664 Y695F possibly damaging Het
Arhgap20 A G 9: 51,848,592 D545G probably damaging Het
Arhgef11 A G 3: 87,735,852 E1457G possibly damaging Het
Atp2b4 T A 1: 133,727,786 I747F probably damaging Het
Bche T A 3: 73,701,800 I98L probably benign Het
C2cd6 TC T 1: 59,094,583 probably null Het
Ccdc90b A G 7: 92,567,735 T72A probably benign Het
Chrd A G 16: 20,735,747 E352G possibly damaging Het
Csmd2 A G 4: 128,383,950 E953G probably benign Het
Dchs2 T A 3: 83,128,534 M196K probably benign Het
Ddx10 G A 9: 53,247,907 Q33* probably null Het
Dennd4b T A 3: 90,268,779 V201E probably damaging Het
Fbn2 T A 18: 58,113,348 H494L probably benign Het
Fbxw13 G A 9: 109,194,727 A83V probably null Het
Fxr1 A G 3: 34,054,303 D321G possibly damaging Het
Gm7298 A G 6: 121,775,809 T837A probably benign Het
Gmppa C G 1: 75,441,747 S258C possibly damaging Het
Hk1 T G 10: 62,281,131 E645A probably damaging Het
Igkv1-132 A G 6: 67,760,340 T97A probably damaging Het
Kcnc1 T C 7: 46,435,292 F547L probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lingo2 T A 4: 35,709,566 E138V probably damaging Het
Myb T C 10: 21,144,966 probably null Het
Mybl1 A G 1: 9,683,128 V243A probably benign Het
Mylk4 C T 13: 32,728,410 S189N probably benign Het
Olfr1133 A G 2: 87,645,323 Y267H probably benign Het
Olfr1267-ps1 A T 2: 90,085,609 I284N probably damaging Het
Olfr1283 A T 2: 111,369,049 Q139L probably benign Het
Olfr1388 A G 11: 49,444,342 M164V probably benign Het
Olfr155 T A 4: 43,855,206 L299* probably null Het
Olfr27 A T 9: 39,144,210 I37F probably benign Het
Oxld1 A T 11: 120,456,824 D182E probably damaging Het
Phf13 A T 4: 151,991,560 L295Q probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prss33 A G 17: 23,834,839 L88P possibly damaging Het
Ralgds A G 2: 28,548,436 Y596C probably damaging Het
Rftn2 A G 1: 55,194,259 I379T possibly damaging Het
Rnf214 C T 9: 45,896,105 E267K probably damaging Het
Rpp14 T C 14: 8,083,717 probably benign Het
Rpusd2 A G 2: 119,035,395 Y191C probably damaging Het
Serpinb9c T A 13: 33,157,824 M1L probably benign Het
Shroom3 A G 5: 92,940,936 D434G probably damaging Het
Smc5 G A 19: 23,214,646 S888L probably benign Het
Suv39h2 C T 2: 3,464,421 R299K probably benign Het
Trappc4 A T 9: 44,404,388 I176N probably damaging Het
Trim12c A T 7: 104,348,130 V73E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Galm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Galm APN 17 80183280 missense probably benign 0.03
IGL02057:Galm APN 17 80181567 missense probably benign 0.05
IGL02212:Galm APN 17 80150117 missense probably benign 0.09
IGL02239:Galm APN 17 80145038 missense probably damaging 1.00
R1442:Galm UTSW 17 80145185 missense probably damaging 0.99
R1511:Galm UTSW 17 80183267 missense probably damaging 1.00
R2129:Galm UTSW 17 80183218 missense probably benign
R2298:Galm UTSW 17 80181697 nonsense probably null
R3724:Galm UTSW 17 80183280 missense probably benign 0.03
R5307:Galm UTSW 17 80144987 nonsense probably null
R5307:Galm UTSW 17 80144988 missense probably damaging 1.00
R5602:Galm UTSW 17 80150139 nonsense probably null
R5778:Galm UTSW 17 80127717 start codon destroyed probably null 1.00
R5873:Galm UTSW 17 80138103 missense probably benign 0.19
R7454:Galm UTSW 17 80138121 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ACCAATTCTGTATTCTGATCAGGG -3'
(R):5'- GCTATTGAAACCGCCACAGG -3'

Sequencing Primer
(F):5'- ATCCTTGGGATCCAGGCTC -3'
(R):5'- GGGAATGCTCCTCAAAATAAGACCTG -3'
Posted On2018-09-12