Incidental Mutation 'R6802:Arfgef1'
ID533361
Institutional Source Beutler Lab
Gene Symbol Arfgef1
Ensembl Gene ENSMUSG00000067851
Gene NameADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited)
SynonymsP200, ARFGEP1, BIG1, D130059B05Rik, D730028O18Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001102430.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6802 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location10137571-10232670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10189452 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 597 (M597K)
Ref Sequence ENSEMBL: ENSMUSP00000085986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088615] [ENSMUST00000131556]
Predicted Effect probably benign
Transcript: ENSMUST00000088615
AA Change: M597K

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000085986
Gene: ENSMUSG00000067851
AA Change: M597K

DomainStartEndE-ValueType
Pfam:DCB 28 213 5.2e-45 PFAM
low complexity region 221 233 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Pfam:Sec7_N 416 575 1.3e-52 PFAM
Blast:Sec7 588 637 6e-24 BLAST
low complexity region 661 681 N/A INTRINSIC
Sec7 692 879 1.15e-105 SMART
Blast:Sec7 897 933 6e-13 BLAST
Blast:Sec7 947 986 8e-18 BLAST
Pfam:DUF1981 1217 1300 3.6e-39 PFAM
low complexity region 1587 1602 N/A INTRINSIC
low complexity region 1777 1782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131556
AA Change: M597K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000118805
Gene: ENSMUSG00000067851
AA Change: M597K

DomainStartEndE-ValueType
coiled coil region 207 234 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Pfam:Sec7_N 413 576 3.1e-59 PFAM
Blast:Sec7 588 637 2e-24 BLAST
low complexity region 661 681 N/A INTRINSIC
Sec7 692 879 1.15e-105 SMART
Blast:Sec7 897 933 3e-13 BLAST
Blast:Sec7 947 986 2e-18 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP. It contains a Sec7 domain, which may be responsible for guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, absent gastric milk and decreased brain size with increased neuron apoptosis, abnormal axon guidance and hypersensitivity to glutamate. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,099,490 K38N probably damaging Het
Agap3 T A 5: 24,487,793 I408N possibly damaging Het
Apold1 G A 6: 134,983,730 R49H probably damaging Het
Apopt1 G T 12: 111,751,191 G162W probably benign Het
Bsn C T 9: 108,110,624 probably benign Het
Ccdc177 A T 12: 80,759,283 D72E probably damaging Het
Ctdp1 A T 18: 80,420,441 probably null Het
Ctsj A T 13: 61,003,074 L190M probably benign Het
Dhx57 A G 17: 80,275,321 F285S probably benign Het
Dnah2 A T 11: 69,423,690 V4051E probably damaging Het
F5 A T 1: 164,179,356 D243V probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbxo30 G T 10: 11,291,480 G649C probably damaging Het
Focad T C 4: 88,274,203 S590P unknown Het
Focad G A 4: 88,344,684 V973I unknown Het
Glb1l3 T C 9: 26,859,352 probably null Het
Gli2 G A 1: 118,842,065 R586C probably damaging Het
Gm6401 T A 14: 41,966,917 E65V probably damaging Het
Gml2 T A 15: 74,824,246 L163H probably damaging Het
Grm6 A T 11: 50,853,389 Q229L probably benign Het
Gtf2h2 T C 13: 100,480,543 M252V probably benign Het
Hsf4 G A 8: 105,274,668 G309S probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Irgq A G 7: 24,531,651 E89G probably benign Het
Kcnj6 T C 16: 94,762,577 N354S probably benign Het
Lrguk A G 6: 34,062,457 H301R probably damaging Het
Mc4r C A 18: 66,859,417 M208I probably benign Het
Mrpl15 A G 1: 4,776,730 S208P probably benign Het
Neil2 A G 14: 63,191,814 F10S probably damaging Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1054 G T 2: 86,333,185 T57K possibly damaging Het
Olfr1186 A G 2: 88,525,597 T5A probably benign Het
Olfr360 A G 2: 37,068,415 M37V probably benign Het
Pacs1 T C 19: 5,152,784 I357V probably damaging Het
Pla2g15 T C 8: 106,150,581 L32P probably damaging Het
Pms1 A T 1: 53,206,792 S529R probably benign Het
Prkra A T 2: 76,633,537 D260E probably damaging Het
Qsox1 A C 1: 155,795,393 F127V probably damaging Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Robo1 T G 16: 72,933,313 V214G probably benign Het
Ryr2 G A 13: 11,686,966 A2935V probably damaging Het
Sgtb A T 13: 104,132,050 Q198L probably benign Het
Slc39a12 C T 2: 14,420,085 L376F probably benign Het
Socs1 C A 16: 10,784,358 V172L probably benign Het
Sprr2k A G 3: 92,433,364 probably benign Het
Tgm1 C T 14: 55,712,482 probably benign Het
Tph2 A T 10: 115,184,873 M6K probably damaging Het
Trav16 T A 14: 53,743,484 C43* probably null Het
Ttll5 A G 12: 85,879,386 E318G probably damaging Het
Vmn2r90 T A 17: 17,712,089 I86N probably damaging Het
Zdhhc19 T C 16: 32,506,358 S165P possibly damaging Het
Zfp352 A T 4: 90,225,200 T526S probably benign Het
Other mutations in Arfgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arfgef1 APN 1 10199787 missense probably benign
IGL00919:Arfgef1 APN 1 10173237 missense probably damaging 1.00
IGL01022:Arfgef1 APN 1 10174076 missense probably damaging 1.00
IGL01155:Arfgef1 APN 1 10198982 splice site probably benign
IGL01288:Arfgef1 APN 1 10213211 missense possibly damaging 0.67
IGL01397:Arfgef1 APN 1 10159571 missense probably benign 0.40
IGL01433:Arfgef1 APN 1 10153432 missense probably damaging 1.00
IGL01653:Arfgef1 APN 1 10159908 nonsense probably null
IGL01669:Arfgef1 APN 1 10159615 missense probably damaging 1.00
IGL01795:Arfgef1 APN 1 10147528 missense probably benign 0.01
IGL01860:Arfgef1 APN 1 10154396 missense probably damaging 1.00
IGL02137:Arfgef1 APN 1 10213113 missense probably damaging 1.00
IGL02365:Arfgef1 APN 1 10199883 missense probably benign 0.00
IGL02519:Arfgef1 APN 1 10209668 missense probably benign 0.13
IGL02542:Arfgef1 APN 1 10172842 missense probably benign 0.24
IGL02604:Arfgef1 APN 1 10181050 splice site probably benign
IGL02743:Arfgef1 APN 1 10199829 missense probably benign 0.00
IGL03225:Arfgef1 APN 1 10154318 missense probably damaging 1.00
Collected UTSW 1 10180938 missense probably damaging 1.00
uncle_joe UTSW 1 10160835 missense probably damaging 1.00
I2288:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
I2289:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
R0383:Arfgef1 UTSW 1 10198842 critical splice donor site probably null
R0491:Arfgef1 UTSW 1 10179987 splice site probably benign
R0636:Arfgef1 UTSW 1 10199851 missense probably benign
R1006:Arfgef1 UTSW 1 10140481 missense probably benign 0.00
R1212:Arfgef1 UTSW 1 10216559 missense probably benign 0.05
R1233:Arfgef1 UTSW 1 10184090 missense probably damaging 1.00
R1346:Arfgef1 UTSW 1 10159733 missense probably benign 0.41
R1416:Arfgef1 UTSW 1 10172939 missense probably damaging 1.00
R1477:Arfgef1 UTSW 1 10189284 missense probably damaging 1.00
R1581:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R1587:Arfgef1 UTSW 1 10159959 missense probably damaging 0.99
R1602:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1745:Arfgef1 UTSW 1 10173255 missense probably damaging 1.00
R1831:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1832:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1833:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1918:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R1919:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2059:Arfgef1 UTSW 1 10188752 splice site probably null
R2146:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2148:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2149:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2150:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2373:Arfgef1 UTSW 1 10174142 missense probably damaging 1.00
R2516:Arfgef1 UTSW 1 10153654 missense possibly damaging 0.89
R3863:Arfgef1 UTSW 1 10142586 frame shift probably null
R3916:Arfgef1 UTSW 1 10189443 missense probably benign 0.01
R3948:Arfgef1 UTSW 1 10142586 frame shift probably null
R3949:Arfgef1 UTSW 1 10142586 frame shift probably null
R3977:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R3978:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R3979:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R4086:Arfgef1 UTSW 1 10163759 missense probably benign 0.06
R4175:Arfgef1 UTSW 1 10159636 missense probably damaging 1.00
R4257:Arfgef1 UTSW 1 10159546 intron probably benign
R4572:Arfgef1 UTSW 1 10213141 missense probably damaging 1.00
R4652:Arfgef1 UTSW 1 10173262 missense probably damaging 0.98
R4678:Arfgef1 UTSW 1 10142666 missense probably benign 0.03
R4737:Arfgef1 UTSW 1 10189611 missense possibly damaging 0.85
R4779:Arfgef1 UTSW 1 10153733 missense probably damaging 1.00
R4818:Arfgef1 UTSW 1 10216547 missense probably benign
R4898:Arfgef1 UTSW 1 10159573 missense possibly damaging 0.75
R4979:Arfgef1 UTSW 1 10213109 missense probably damaging 1.00
R5039:Arfgef1 UTSW 1 10199736 missense probably benign 0.37
R5194:Arfgef1 UTSW 1 10204907 missense probably benign 0.09
R5428:Arfgef1 UTSW 1 10160835 missense probably damaging 1.00
R5533:Arfgef1 UTSW 1 10199727 critical splice donor site probably null
R5547:Arfgef1 UTSW 1 10160976 missense probably damaging 1.00
R5562:Arfgef1 UTSW 1 10144746 missense probably damaging 1.00
R5635:Arfgef1 UTSW 1 10188860 missense possibly damaging 0.81
R5697:Arfgef1 UTSW 1 10160838 missense probably benign 0.03
R5704:Arfgef1 UTSW 1 10159583 missense probably damaging 0.98
R5722:Arfgef1 UTSW 1 10138884 missense probably benign 0.04
R5793:Arfgef1 UTSW 1 10209528 missense probably benign 0.01
R5835:Arfgef1 UTSW 1 10160739 missense probably damaging 1.00
R5870:Arfgef1 UTSW 1 10180938 missense probably damaging 1.00
R5990:Arfgef1 UTSW 1 10172921 missense probably damaging 0.99
R6290:Arfgef1 UTSW 1 10188811 missense possibly damaging 0.91
R6460:Arfgef1 UTSW 1 10213060 missense probably damaging 1.00
R6613:Arfgef1 UTSW 1 10194396 missense possibly damaging 0.95
R6967:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6967:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6968:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6968:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6969:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6969:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6970:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6970:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R7092:Arfgef1 UTSW 1 10153676 missense probably damaging 1.00
R7251:Arfgef1 UTSW 1 10198975 missense possibly damaging 0.81
R7334:Arfgef1 UTSW 1 10184460 missense probably damaging 1.00
R7399:Arfgef1 UTSW 1 10180897 missense probably benign 0.00
R7631:Arfgef1 UTSW 1 10232469 missense probably benign 0.00
R7699:Arfgef1 UTSW 1 10194411 missense possibly damaging 0.78
R7700:Arfgef1 UTSW 1 10194411 missense possibly damaging 0.78
V1662:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGGTTCACATACTGATCC -3'
(R):5'- AACGTCTACAAGCTCATTTGAC -3'

Sequencing Primer
(F):5'- GGGTTCACATACTGATCCTTGCTC -3'
(R):5'- CGTCTACAAGCTCATTTGACCATAAG -3'
Posted On2018-09-12