Incidental Mutation 'R6802:Pms1'
ID533362
Institutional Source Beutler Lab
Gene Symbol Pms1
Ensembl Gene ENSMUSG00000026098
Gene NamePMS1 homolog 1, mismatch repair system component
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6802 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location53189187-53297018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53206792 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 529 (S529R)
Ref Sequence ENSEMBL: ENSMUSP00000119632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027267] [ENSMUST00000135246]
Predicted Effect probably benign
Transcript: ENSMUST00000027267
AA Change: S529R

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000027267
Gene: ENSMUSG00000026098
AA Change: S529R

DomainStartEndE-ValueType
HATPase_c 16 151 3.84e-1 SMART
DNA_mis_repair 210 338 2.46e-25 SMART
low complexity region 457 474 N/A INTRINSIC
HMG 557 627 1.42e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135246
AA Change: S529R

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119632
Gene: ENSMUSG00000026098
AA Change: S529R

DomainStartEndE-ValueType
HATPase_c 16 151 3.84e-1 SMART
DNA_mis_repair 210 338 2.46e-25 SMART
low complexity region 457 474 N/A INTRINSIC
HMG 557 627 1.42e-17 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the DNA mismatch repair mutL/hexB family. This protein is thought to be involved in the repair of DNA mismatches, and it can form heterodimers with MLH1, a known DNA mismatch repair protein. Mutations in this gene cause hereditary nonpolyposis colorectal cancer type 3 (HNPCC3) either alone or in combination with mutations in other genes involved in the HNPCC phenotype, which is also known as Lynch syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a modest increase in DNA mismatch repair errors, primarily single base pair substitutions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,099,490 K38N probably damaging Het
Agap3 T A 5: 24,487,793 I408N possibly damaging Het
Apold1 G A 6: 134,983,730 R49H probably damaging Het
Apopt1 G T 12: 111,751,191 G162W probably benign Het
Arfgef1 A T 1: 10,189,452 M597K probably benign Het
Bsn C T 9: 108,110,624 probably benign Het
Ccdc177 A T 12: 80,759,283 D72E probably damaging Het
Ctdp1 A T 18: 80,420,441 probably null Het
Ctsj A T 13: 61,003,074 L190M probably benign Het
Dhx57 A G 17: 80,275,321 F285S probably benign Het
Dnah2 A T 11: 69,423,690 V4051E probably damaging Het
F5 A T 1: 164,179,356 D243V probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbxo30 G T 10: 11,291,480 G649C probably damaging Het
Focad T C 4: 88,274,203 S590P unknown Het
Focad G A 4: 88,344,684 V973I unknown Het
Glb1l3 T C 9: 26,859,352 probably null Het
Gli2 G A 1: 118,842,065 R586C probably damaging Het
Gm6401 T A 14: 41,966,917 E65V probably damaging Het
Gml2 T A 15: 74,824,246 L163H probably damaging Het
Grm6 A T 11: 50,853,389 Q229L probably benign Het
Gtf2h2 T C 13: 100,480,543 M252V probably benign Het
Hsf4 G A 8: 105,274,668 G309S probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Irgq A G 7: 24,531,651 E89G probably benign Het
Kcnj6 T C 16: 94,762,577 N354S probably benign Het
Lrguk A G 6: 34,062,457 H301R probably damaging Het
Mc4r C A 18: 66,859,417 M208I probably benign Het
Mrpl15 A G 1: 4,776,730 S208P probably benign Het
Neil2 A G 14: 63,191,814 F10S probably damaging Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1054 G T 2: 86,333,185 T57K possibly damaging Het
Olfr1186 A G 2: 88,525,597 T5A probably benign Het
Olfr360 A G 2: 37,068,415 M37V probably benign Het
Pacs1 T C 19: 5,152,784 I357V probably damaging Het
Pla2g15 T C 8: 106,150,581 L32P probably damaging Het
Prkra A T 2: 76,633,537 D260E probably damaging Het
Qsox1 A C 1: 155,795,393 F127V probably damaging Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Robo1 T G 16: 72,933,313 V214G probably benign Het
Ryr2 G A 13: 11,686,966 A2935V probably damaging Het
Sgtb A T 13: 104,132,050 Q198L probably benign Het
Slc39a12 C T 2: 14,420,085 L376F probably benign Het
Socs1 C A 16: 10,784,358 V172L probably benign Het
Sprr2k A G 3: 92,433,364 probably benign Het
Tgm1 C T 14: 55,712,482 probably benign Het
Tph2 A T 10: 115,184,873 M6K probably damaging Het
Trav16 T A 14: 53,743,484 C43* probably null Het
Ttll5 A G 12: 85,879,386 E318G probably damaging Het
Vmn2r90 T A 17: 17,712,089 I86N probably damaging Het
Zdhhc19 T C 16: 32,506,358 S165P possibly damaging Het
Zfp352 A T 4: 90,225,200 T526S probably benign Het
Other mutations in Pms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Pms1 APN 1 53206556 splice site probably benign
IGL00937:Pms1 APN 1 53275251 missense possibly damaging 0.74
IGL01505:Pms1 APN 1 53206971 missense probably benign
IGL02109:Pms1 APN 1 53207409 missense probably damaging 0.96
IGL02245:Pms1 APN 1 53207360 missense probably damaging 1.00
IGL02273:Pms1 APN 1 53207997 missense probably damaging 1.00
IGL02339:Pms1 APN 1 53275165 missense possibly damaging 0.78
R0157:Pms1 UTSW 1 53195037 nonsense probably null
R0530:Pms1 UTSW 1 53196813 unclassified probably null
R1398:Pms1 UTSW 1 53207276 missense possibly damaging 0.88
R1817:Pms1 UTSW 1 53206969 missense probably benign 0.02
R1831:Pms1 UTSW 1 53207211 missense probably benign 0.00
R1838:Pms1 UTSW 1 53192098 critical splice donor site probably null
R1867:Pms1 UTSW 1 53189387 missense probably benign 0.36
R1874:Pms1 UTSW 1 53207233 missense probably benign 0.16
R1939:Pms1 UTSW 1 53196976 missense probably damaging 1.00
R1991:Pms1 UTSW 1 53282042 missense probably damaging 1.00
R1993:Pms1 UTSW 1 53195015 missense probably benign
R1995:Pms1 UTSW 1 53195015 missense probably benign
R2049:Pms1 UTSW 1 53281988 missense probably damaging 0.99
R2058:Pms1 UTSW 1 53275168 missense probably benign 0.00
R2140:Pms1 UTSW 1 53281988 missense probably damaging 0.99
R4078:Pms1 UTSW 1 53267789 unclassified probably null
R4608:Pms1 UTSW 1 53194938 missense possibly damaging 0.80
R4668:Pms1 UTSW 1 53189474 nonsense probably null
R5164:Pms1 UTSW 1 53207640 missense probably damaging 0.99
R5200:Pms1 UTSW 1 53206757 missense probably benign 0.00
R5397:Pms1 UTSW 1 53192120 nonsense probably null
R5745:Pms1 UTSW 1 53207702 nonsense probably null
R6440:Pms1 UTSW 1 53195021 missense probably damaging 0.98
R6445:Pms1 UTSW 1 53192194 missense possibly damaging 0.77
R6975:Pms1 UTSW 1 53189431 missense probably damaging 0.99
R7020:Pms1 UTSW 1 53189382 missense probably damaging 1.00
R7037:Pms1 UTSW 1 53207611 missense possibly damaging 0.95
R7199:Pms1 UTSW 1 53256730 missense probably benign 0.02
R7417:Pms1 UTSW 1 53197072 missense probably benign 0.00
R7587:Pms1 UTSW 1 53207316 missense probably benign 0.00
R7716:Pms1 UTSW 1 53207608 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGGAGACCTACTTGTGC -3'
(R):5'- ACACTTCCTGAGAAAGCTCTG -3'

Sequencing Primer
(F):5'- GGAGACCTACTTGTGCTTTTCC -3'
(R):5'- GCTCTGGAAATCTGTGCAGAC -3'
Posted On2018-09-12