Incidental Mutation 'R6802:Qsox1'
ID533364
Institutional Source Beutler Lab
Gene Symbol Qsox1
Ensembl Gene ENSMUSG00000033684
Gene Namequiescin Q6 sulfhydryl oxidase 1
SynonymsQscn6, QSOX, 1300003H02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.590) question?
Stock #R6802 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location155776029-155812889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 155795393 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 127 (F127V)
Ref Sequence ENSEMBL: ENSMUSP00000107394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035325] [ENSMUST00000111764] [ENSMUST00000194632]
Predicted Effect probably damaging
Transcript: ENSMUST00000035325
AA Change: F127V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035658
Gene: ENSMUSG00000033684
AA Change: F127V

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:Thioredoxin 46 149 9e-18 PFAM
low complexity region 276 286 N/A INTRINSIC
Pfam:Evr1_Alr 408 507 7e-29 PFAM
low complexity region 679 692 N/A INTRINSIC
low complexity region 693 705 N/A INTRINSIC
transmembrane domain 709 731 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111764
AA Change: F127V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107394
Gene: ENSMUSG00000033684
AA Change: F127V

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:Thioredoxin 45 149 1.7e-18 PFAM
low complexity region 276 286 N/A INTRINSIC
Pfam:Evr1_Alr 408 508 1.5e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000194632
AA Change: F127V

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142301
Gene: ENSMUSG00000033684
AA Change: F127V

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:Thioredoxin 45 149 1.3e-18 PFAM
low complexity region 276 286 N/A INTRINSIC
Pfam:Evr1_Alr 408 508 1.2e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that this gene plays an important role in growth regulation. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for an ENU-induced mutation show cardiovascular phenotypes including persistent truncus arteriosus, atriventricular septal defects and vascular ring, as well as eye defects, short snout, micrognathia, cleft palate, tracheosophageal fistula, polydactyly and spleen hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,099,490 K38N probably damaging Het
Agap3 T A 5: 24,487,793 I408N possibly damaging Het
Apold1 G A 6: 134,983,730 R49H probably damaging Het
Apopt1 G T 12: 111,751,191 G162W probably benign Het
Arfgef1 A T 1: 10,189,452 M597K probably benign Het
Bsn C T 9: 108,110,624 probably benign Het
Ccdc177 A T 12: 80,759,283 D72E probably damaging Het
Ctdp1 A T 18: 80,420,441 probably null Het
Ctsj A T 13: 61,003,074 L190M probably benign Het
Dhx57 A G 17: 80,275,321 F285S probably benign Het
Dnah2 A T 11: 69,423,690 V4051E probably damaging Het
F5 A T 1: 164,179,356 D243V probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbxo30 G T 10: 11,291,480 G649C probably damaging Het
Focad T C 4: 88,274,203 S590P unknown Het
Focad G A 4: 88,344,684 V973I unknown Het
Glb1l3 T C 9: 26,859,352 probably null Het
Gli2 G A 1: 118,842,065 R586C probably damaging Het
Gm6401 T A 14: 41,966,917 E65V probably damaging Het
Gml2 T A 15: 74,824,246 L163H probably damaging Het
Grm6 A T 11: 50,853,389 Q229L probably benign Het
Gtf2h2 T C 13: 100,480,543 M252V probably benign Het
Hsf4 G A 8: 105,274,668 G309S probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Irgq A G 7: 24,531,651 E89G probably benign Het
Kcnj6 T C 16: 94,762,577 N354S probably benign Het
Lrguk A G 6: 34,062,457 H301R probably damaging Het
Mc4r C A 18: 66,859,417 M208I probably benign Het
Mrpl15 A G 1: 4,776,730 S208P probably benign Het
Neil2 A G 14: 63,191,814 F10S probably damaging Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1054 G T 2: 86,333,185 T57K possibly damaging Het
Olfr1186 A G 2: 88,525,597 T5A probably benign Het
Olfr360 A G 2: 37,068,415 M37V probably benign Het
Pacs1 T C 19: 5,152,784 I357V probably damaging Het
Pla2g15 T C 8: 106,150,581 L32P probably damaging Het
Pms1 A T 1: 53,206,792 S529R probably benign Het
Prkra A T 2: 76,633,537 D260E probably damaging Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Robo1 T G 16: 72,933,313 V214G probably benign Het
Ryr2 G A 13: 11,686,966 A2935V probably damaging Het
Sgtb A T 13: 104,132,050 Q198L probably benign Het
Slc39a12 C T 2: 14,420,085 L376F probably benign Het
Socs1 C A 16: 10,784,358 V172L probably benign Het
Sprr2k A G 3: 92,433,364 probably benign Het
Tgm1 C T 14: 55,712,482 probably benign Het
Tph2 A T 10: 115,184,873 M6K probably damaging Het
Trav16 T A 14: 53,743,484 C43* probably null Het
Ttll5 A G 12: 85,879,386 E318G probably damaging Het
Vmn2r90 T A 17: 17,712,089 I86N probably damaging Het
Zdhhc19 T C 16: 32,506,358 S165P possibly damaging Het
Zfp352 A T 4: 90,225,200 T526S probably benign Het
Other mutations in Qsox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02392:Qsox1 APN 1 155812600 missense probably damaging 1.00
BB003:Qsox1 UTSW 1 155812787 missense unknown
BB013:Qsox1 UTSW 1 155812787 missense unknown
R1799:Qsox1 UTSW 1 155794618 missense probably null
R1833:Qsox1 UTSW 1 155791045 missense probably benign 0.15
R1874:Qsox1 UTSW 1 155812639 missense possibly damaging 0.85
R4282:Qsox1 UTSW 1 155786925 critical splice acceptor site probably null
R4938:Qsox1 UTSW 1 155779668 missense probably benign 0.01
R5081:Qsox1 UTSW 1 155812835 utr 5 prime probably benign
R5217:Qsox1 UTSW 1 155790996 missense probably benign 0.00
R5303:Qsox1 UTSW 1 155779293 missense probably benign 0.01
R5761:Qsox1 UTSW 1 155779528 missense probably benign
R5763:Qsox1 UTSW 1 155779879 missense probably benign
R5932:Qsox1 UTSW 1 155789333 missense probably benign
R6765:Qsox1 UTSW 1 155791105 missense probably benign 0.00
R7926:Qsox1 UTSW 1 155812787 missense unknown
R8857:Qsox1 UTSW 1 155782587 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TTTCTGCCAGGCTCTCTGAG -3'
(R):5'- TTACATTCCTGAGCTGCTGC -3'

Sequencing Primer
(F):5'- CCAGGCTCTCTGAGAAGACATATG -3'
(R):5'- AGCTGCTGCCTTCAGGTTCTAAG -3'
Posted On2018-09-12