Incidental Mutation 'R6802:Prkra'
ID533369
Institutional Source Beutler Lab
Gene Symbol Prkra
Ensembl Gene ENSMUSG00000002731
Gene Nameprotein kinase, interferon inducible double stranded RNA dependent activator
Synonymslear, PRK, Pact, RAX
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.575) question?
Stock #R6802 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location76629898-76648015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76633537 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 260 (D260E)
Ref Sequence ENSEMBL: ENSMUSP00000002808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002808]
Predicted Effect probably damaging
Transcript: ENSMUST00000002808
AA Change: D260E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002808
Gene: ENSMUSG00000002731
AA Change: D260E

DomainStartEndE-ValueType
DSRM 35 100 4.63e-24 SMART
DSRM 127 193 2.23e-17 SMART
DSRM 241 307 1.16e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein kinase activated by double-stranded RNA which mediates the effects of interferon in response to viral infection. Mutations in this gene have been associated with dystonia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a deletion of the entire gene show embryonic lethality prior to implantation. Mice homozygous for a deletion in the last exon are viable but exhibit small size, turbinate hypoplasia, short snout, severe microtia, outer and middle ear defects, and impaired hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,099,490 K38N probably damaging Het
Agap3 T A 5: 24,487,793 I408N possibly damaging Het
Apold1 G A 6: 134,983,730 R49H probably damaging Het
Apopt1 G T 12: 111,751,191 G162W probably benign Het
Arfgef1 A T 1: 10,189,452 M597K probably benign Het
Bsn C T 9: 108,110,624 probably benign Het
Ccdc177 A T 12: 80,759,283 D72E probably damaging Het
Ctdp1 A T 18: 80,420,441 probably null Het
Ctsj A T 13: 61,003,074 L190M probably benign Het
Dhx57 A G 17: 80,275,321 F285S probably benign Het
Dnah2 A T 11: 69,423,690 V4051E probably damaging Het
F5 A T 1: 164,179,356 D243V probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbxo30 G T 10: 11,291,480 G649C probably damaging Het
Focad T C 4: 88,274,203 S590P unknown Het
Focad G A 4: 88,344,684 V973I unknown Het
Glb1l3 T C 9: 26,859,352 probably null Het
Gli2 G A 1: 118,842,065 R586C probably damaging Het
Gm6401 T A 14: 41,966,917 E65V probably damaging Het
Gml2 T A 15: 74,824,246 L163H probably damaging Het
Grm6 A T 11: 50,853,389 Q229L probably benign Het
Gtf2h2 T C 13: 100,480,543 M252V probably benign Het
Hsf4 G A 8: 105,274,668 G309S probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Irgq A G 7: 24,531,651 E89G probably benign Het
Kcnj6 T C 16: 94,762,577 N354S probably benign Het
Lrguk A G 6: 34,062,457 H301R probably damaging Het
Mc4r C A 18: 66,859,417 M208I probably benign Het
Mrpl15 A G 1: 4,776,730 S208P probably benign Het
Neil2 A G 14: 63,191,814 F10S probably damaging Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1054 G T 2: 86,333,185 T57K possibly damaging Het
Olfr1186 A G 2: 88,525,597 T5A probably benign Het
Olfr360 A G 2: 37,068,415 M37V probably benign Het
Pacs1 T C 19: 5,152,784 I357V probably damaging Het
Pla2g15 T C 8: 106,150,581 L32P probably damaging Het
Pms1 A T 1: 53,206,792 S529R probably benign Het
Qsox1 A C 1: 155,795,393 F127V probably damaging Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Robo1 T G 16: 72,933,313 V214G probably benign Het
Ryr2 G A 13: 11,686,966 A2935V probably damaging Het
Sgtb A T 13: 104,132,050 Q198L probably benign Het
Slc39a12 C T 2: 14,420,085 L376F probably benign Het
Socs1 C A 16: 10,784,358 V172L probably benign Het
Sprr2k A G 3: 92,433,364 probably benign Het
Tgm1 C T 14: 55,712,482 probably benign Het
Tph2 A T 10: 115,184,873 M6K probably damaging Het
Trav16 T A 14: 53,743,484 C43* probably null Het
Ttll5 A G 12: 85,879,386 E318G probably damaging Het
Vmn2r90 T A 17: 17,712,089 I86N probably damaging Het
Zdhhc19 T C 16: 32,506,358 S165P possibly damaging Het
Zfp352 A T 4: 90,225,200 T526S probably benign Het
Other mutations in Prkra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Prkra APN 2 76630436 missense probably damaging 1.00
IGL02016:Prkra APN 2 76643309 splice site probably null
IGL02823:Prkra APN 2 76630424 missense probably damaging 1.00
IGL02962:Prkra APN 2 76633547 missense probably damaging 1.00
IGL03265:Prkra APN 2 76640270 missense probably benign 0.06
R1520:Prkra UTSW 2 76639278 missense possibly damaging 0.62
R1609:Prkra UTSW 2 76633592 missense probably benign 0.06
R1751:Prkra UTSW 2 76647240 missense possibly damaging 0.63
R1767:Prkra UTSW 2 76647240 missense possibly damaging 0.63
R2131:Prkra UTSW 2 76647136 missense probably damaging 1.00
R5288:Prkra UTSW 2 76639278 missense probably damaging 0.99
R5385:Prkra UTSW 2 76639278 missense probably damaging 0.99
R5386:Prkra UTSW 2 76639278 missense probably damaging 0.99
R6918:Prkra UTSW 2 76630453 missense probably damaging 1.00
R7445:Prkra UTSW 2 76633598 missense probably benign 0.25
R7471:Prkra UTSW 2 76647201 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGATATCACATTGTTCTGATGC -3'
(R):5'- CGAACGTGGTTGGACATTCC -3'

Sequencing Primer
(F):5'- TCATGACACTAAACATGCATGTAC -3'
(R):5'- GGACATTCCCTAGGATGCACTTG -3'
Posted On2018-09-12