Incidental Mutation 'R6802:Olfr1054'
ID533370
Institutional Source Beutler Lab
Gene Symbol Olfr1054
Ensembl Gene ENSMUSG00000075190
Gene Nameolfactory receptor 1054
SynonymsGA_x6K02T2Q125-47811880-47810942, MOR188-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6802 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86332135-86335433 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86333185 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 57 (T57K)
Ref Sequence ENSEMBL: ENSMUSP00000150810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099895] [ENSMUST00000213205]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099895
AA Change: T57K

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097480
Gene: ENSMUSG00000075190
AA Change: T57K

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.8e-49 PFAM
Pfam:7tm_1 41 289 5.5e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213205
AA Change: T57K

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,099,490 K38N probably damaging Het
Agap3 T A 5: 24,487,793 I408N possibly damaging Het
Apold1 G A 6: 134,983,730 R49H probably damaging Het
Apopt1 G T 12: 111,751,191 G162W probably benign Het
Arfgef1 A T 1: 10,189,452 M597K probably benign Het
Bsn C T 9: 108,110,624 probably benign Het
Ccdc177 A T 12: 80,759,283 D72E probably damaging Het
Ctdp1 A T 18: 80,420,441 probably null Het
Ctsj A T 13: 61,003,074 L190M probably benign Het
Dhx57 A G 17: 80,275,321 F285S probably benign Het
Dnah2 A T 11: 69,423,690 V4051E probably damaging Het
F5 A T 1: 164,179,356 D243V probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbxo30 G T 10: 11,291,480 G649C probably damaging Het
Focad T C 4: 88,274,203 S590P unknown Het
Focad G A 4: 88,344,684 V973I unknown Het
Glb1l3 T C 9: 26,859,352 probably null Het
Gli2 G A 1: 118,842,065 R586C probably damaging Het
Gm6401 T A 14: 41,966,917 E65V probably damaging Het
Gml2 T A 15: 74,824,246 L163H probably damaging Het
Grm6 A T 11: 50,853,389 Q229L probably benign Het
Gtf2h2 T C 13: 100,480,543 M252V probably benign Het
Hsf4 G A 8: 105,274,668 G309S probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Irgq A G 7: 24,531,651 E89G probably benign Het
Kcnj6 T C 16: 94,762,577 N354S probably benign Het
Lrguk A G 6: 34,062,457 H301R probably damaging Het
Mc4r C A 18: 66,859,417 M208I probably benign Het
Mrpl15 A G 1: 4,776,730 S208P probably benign Het
Neil2 A G 14: 63,191,814 F10S probably damaging Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1186 A G 2: 88,525,597 T5A probably benign Het
Olfr360 A G 2: 37,068,415 M37V probably benign Het
Pacs1 T C 19: 5,152,784 I357V probably damaging Het
Pla2g15 T C 8: 106,150,581 L32P probably damaging Het
Pms1 A T 1: 53,206,792 S529R probably benign Het
Prkra A T 2: 76,633,537 D260E probably damaging Het
Qsox1 A C 1: 155,795,393 F127V probably damaging Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Robo1 T G 16: 72,933,313 V214G probably benign Het
Ryr2 G A 13: 11,686,966 A2935V probably damaging Het
Sgtb A T 13: 104,132,050 Q198L probably benign Het
Slc39a12 C T 2: 14,420,085 L376F probably benign Het
Socs1 C A 16: 10,784,358 V172L probably benign Het
Sprr2k A G 3: 92,433,364 probably benign Het
Tgm1 C T 14: 55,712,482 probably benign Het
Tph2 A T 10: 115,184,873 M6K probably damaging Het
Trav16 T A 14: 53,743,484 C43* probably null Het
Ttll5 A G 12: 85,879,386 E318G probably damaging Het
Vmn2r90 T A 17: 17,712,089 I86N probably damaging Het
Zdhhc19 T C 16: 32,506,358 S165P possibly damaging Het
Zfp352 A T 4: 90,225,200 T526S probably benign Het
Other mutations in Olfr1054
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Olfr1054 APN 2 86332704 nonsense probably null
IGL02266:Olfr1054 APN 2 86332979 missense probably damaging 0.98
IGL02398:Olfr1054 APN 2 86332524 nonsense probably null
IGL02535:Olfr1054 APN 2 86332675 missense probably damaging 1.00
IGL02590:Olfr1054 APN 2 86333000 missense possibly damaging 0.52
IGL02630:Olfr1054 APN 2 86332868 missense probably benign 0.39
PIT4151001:Olfr1054 UTSW 2 86332829 missense possibly damaging 0.60
R0520:Olfr1054 UTSW 2 86333131 missense probably damaging 1.00
R1079:Olfr1054 UTSW 2 86332841 missense probably damaging 0.96
R1887:Olfr1054 UTSW 2 86333273 missense possibly damaging 0.90
R2037:Olfr1054 UTSW 2 86332430 missense probably benign 0.03
R2120:Olfr1054 UTSW 2 86333345 missense probably benign 0.00
R2153:Olfr1054 UTSW 2 86332528 missense probably damaging 1.00
R4523:Olfr1054 UTSW 2 86333300 missense probably benign 0.12
R4836:Olfr1054 UTSW 2 86333227 missense probably benign 0.12
R6147:Olfr1054 UTSW 2 86332500 missense probably damaging 1.00
R6886:Olfr1054 UTSW 2 86333064 nonsense probably null
R6894:Olfr1054 UTSW 2 86332951 missense probably damaging 1.00
R7275:Olfr1054 UTSW 2 86332792 missense possibly damaging 0.91
R7322:Olfr1054 UTSW 2 86332564 missense probably benign 0.14
R7325:Olfr1054 UTSW 2 86333000 missense possibly damaging 0.52
R7526:Olfr1054 UTSW 2 86333353 start codon destroyed probably null 1.00
R7976:Olfr1054 UTSW 2 86332720 missense probably benign 0.05
R8421:Olfr1054 UTSW 2 86332903 missense possibly damaging 0.80
R8838:Olfr1054 UTSW 2 86332973 missense possibly damaging 0.61
Z1176:Olfr1054 UTSW 2 86332706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGCTTACAGATGGCCAC -3'
(R):5'- TCTAAGCCTAGATGGAGAAACGC -3'

Sequencing Primer
(F):5'- TTACAGATGGCCACATAGCGGTC -3'
(R):5'- TAGATGGAGAAACGCAACCTC -3'
Posted On2018-09-12