Incidental Mutation 'R6802:Lrguk'
ID 533377
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 044915-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R6802 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 34006379-34110969 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34039392 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 301 (H301R)
Ref Sequence ENSEMBL: ENSMUSP00000065146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
AlphaFold Q9D5S7
Predicted Effect probably damaging
Transcript: ENSMUST00000070189
AA Change: H301R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: H301R

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228187
AA Change: H301R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 115,698,725 (GRCm39) K38N probably damaging Het
Agap3 T A 5: 24,692,791 (GRCm39) I408N possibly damaging Het
Apold1 G A 6: 134,960,693 (GRCm39) R49H probably damaging Het
Arfgef1 A T 1: 10,259,677 (GRCm39) M597K probably benign Het
Bsn C T 9: 107,987,823 (GRCm39) probably benign Het
Ccdc177 A T 12: 80,806,057 (GRCm39) D72E probably damaging Het
Coa8 G T 12: 111,717,625 (GRCm39) G162W probably benign Het
Ctdp1 A T 18: 80,463,656 (GRCm39) probably null Het
Ctsj A T 13: 61,150,888 (GRCm39) L190M probably benign Het
Dhx57 A G 17: 80,582,750 (GRCm39) F285S probably benign Het
Dnah2 A T 11: 69,314,516 (GRCm39) V4051E probably damaging Het
F5 A T 1: 164,006,925 (GRCm39) D243V probably damaging Het
Fat3 C T 9: 15,826,357 (GRCm39) E4532K possibly damaging Het
Fbxo30 G T 10: 11,167,224 (GRCm39) G649C probably damaging Het
Focad T C 4: 88,192,440 (GRCm39) S590P unknown Het
Focad G A 4: 88,262,921 (GRCm39) V973I unknown Het
Glb1l3 T C 9: 26,770,648 (GRCm39) probably null Het
Gli2 G A 1: 118,769,795 (GRCm39) R586C probably damaging Het
Gm6401 T A 14: 41,788,874 (GRCm39) E65V probably damaging Het
Gml2 T A 15: 74,696,095 (GRCm39) L163H probably damaging Het
Grm6 A T 11: 50,744,216 (GRCm39) Q229L probably benign Het
Gtf2h2 T C 13: 100,617,051 (GRCm39) M252V probably benign Het
Hsf4 G A 8: 106,001,300 (GRCm39) G309S probably damaging Het
Iglc1 T C 16: 18,880,660 (GRCm39) probably benign Het
Irgq A G 7: 24,231,076 (GRCm39) E89G probably benign Het
Kcnj6 T C 16: 94,563,436 (GRCm39) N354S probably benign Het
Mc4r C A 18: 66,992,488 (GRCm39) M208I probably benign Het
Mrpl15 A G 1: 4,846,953 (GRCm39) S208P probably benign Het
Neil2 A G 14: 63,429,263 (GRCm39) F10S probably damaging Het
Nrg1 T C 8: 32,311,292 (GRCm39) R476G probably damaging Het
Or12k7 A G 2: 36,958,427 (GRCm39) M37V probably benign Het
Or4c100 A G 2: 88,355,941 (GRCm39) T5A probably benign Het
Or8k22 G T 2: 86,163,529 (GRCm39) T57K possibly damaging Het
Pacs1 T C 19: 5,202,812 (GRCm39) I357V probably damaging Het
Pla2g15 T C 8: 106,877,213 (GRCm39) L32P probably damaging Het
Pms1 A T 1: 53,245,951 (GRCm39) S529R probably benign Het
Prkra A T 2: 76,463,881 (GRCm39) D260E probably damaging Het
Qsox1 A C 1: 155,671,139 (GRCm39) F127V probably damaging Het
Rabgap1l A T 1: 160,561,250 (GRCm39) V161E probably benign Het
Robo1 T G 16: 72,730,201 (GRCm39) V214G probably benign Het
Ryr2 G A 13: 11,701,852 (GRCm39) A2935V probably damaging Het
Sgtb A T 13: 104,268,558 (GRCm39) Q198L probably benign Het
Slc39a12 C T 2: 14,424,896 (GRCm39) L376F probably benign Het
Socs1 C A 16: 10,602,222 (GRCm39) V172L probably benign Het
Sprr2k A G 3: 92,340,671 (GRCm39) probably benign Het
Tgm1 C T 14: 55,949,939 (GRCm39) probably benign Het
Tph2 A T 10: 115,020,778 (GRCm39) M6K probably damaging Het
Trav16 T A 14: 53,980,941 (GRCm39) C43* probably null Het
Ttll5 A G 12: 85,926,160 (GRCm39) E318G probably damaging Het
Vmn2r90 T A 17: 17,932,351 (GRCm39) I86N probably damaging Het
Zdhhc19 T C 16: 32,325,176 (GRCm39) S165P possibly damaging Het
Zfp352 A T 4: 90,113,437 (GRCm39) T526S probably benign Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34,020,364 (GRCm39) missense probably damaging 1.00
IGL00566:Lrguk APN 6 34,033,109 (GRCm39) missense probably damaging 1.00
IGL01720:Lrguk APN 6 34,020,412 (GRCm39) missense probably damaging 1.00
IGL02325:Lrguk APN 6 34,106,114 (GRCm39) missense probably benign 0.31
IGL02484:Lrguk APN 6 34,069,726 (GRCm39) missense probably damaging 1.00
IGL02493:Lrguk APN 6 34,106,127 (GRCm39) missense probably benign 0.03
IGL02636:Lrguk APN 6 34,067,123 (GRCm39) missense probably damaging 1.00
IGL03278:Lrguk APN 6 34,093,381 (GRCm39) missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34,020,431 (GRCm39) missense probably damaging 0.99
R1069:Lrguk UTSW 6 34,025,818 (GRCm39) missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34,039,295 (GRCm39) missense probably benign 0.01
R1568:Lrguk UTSW 6 34,063,373 (GRCm39) missense probably damaging 1.00
R1604:Lrguk UTSW 6 34,049,305 (GRCm39) missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34,110,322 (GRCm39) missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34,048,003 (GRCm39) missense probably damaging 1.00
R2107:Lrguk UTSW 6 34,039,296 (GRCm39) missense probably benign 0.15
R2125:Lrguk UTSW 6 34,069,837 (GRCm39) missense probably benign 0.05
R2136:Lrguk UTSW 6 34,020,454 (GRCm39) missense probably benign 0.00
R2997:Lrguk UTSW 6 34,050,697 (GRCm39) missense probably damaging 0.98
R3847:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R3849:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R4626:Lrguk UTSW 6 34,106,158 (GRCm39) missense probably benign 0.00
R4718:Lrguk UTSW 6 34,006,431 (GRCm39) missense probably benign 0.02
R4778:Lrguk UTSW 6 34,033,015 (GRCm39) missense probably damaging 1.00
R4841:Lrguk UTSW 6 34,069,802 (GRCm39) missense probably damaging 0.98
R5324:Lrguk UTSW 6 34,050,732 (GRCm39) missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34,047,996 (GRCm39) missense probably damaging 1.00
R5741:Lrguk UTSW 6 34,025,802 (GRCm39) missense probably damaging 0.99
R5939:Lrguk UTSW 6 34,055,688 (GRCm39) missense probably damaging 1.00
R5997:Lrguk UTSW 6 34,106,078 (GRCm39) missense probably damaging 0.99
R6786:Lrguk UTSW 6 34,072,522 (GRCm39) missense probably benign 0.11
R7081:Lrguk UTSW 6 34,079,074 (GRCm39) missense probably benign 0.01
R7303:Lrguk UTSW 6 34,006,411 (GRCm39) missense probably benign 0.00
R7316:Lrguk UTSW 6 34,080,191 (GRCm39) missense unknown
R7473:Lrguk UTSW 6 34,006,630 (GRCm39) missense probably benign 0.01
R7543:Lrguk UTSW 6 34,025,870 (GRCm39) nonsense probably null
R7613:Lrguk UTSW 6 34,078,683 (GRCm39) missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34,072,474 (GRCm39) missense probably damaging 1.00
R7900:Lrguk UTSW 6 34,106,129 (GRCm39) missense probably benign 0.01
R8012:Lrguk UTSW 6 34,033,038 (GRCm39) missense probably benign 0.00
R8251:Lrguk UTSW 6 34,093,374 (GRCm39) missense probably benign 0.00
R8324:Lrguk UTSW 6 34,079,506 (GRCm39) missense probably benign 0.03
R8551:Lrguk UTSW 6 34,093,446 (GRCm39) missense probably damaging 0.96
R8828:Lrguk UTSW 6 34,080,572 (GRCm39) missense unknown
R8879:Lrguk UTSW 6 34,006,618 (GRCm39) missense probably benign 0.00
X0057:Lrguk UTSW 6 34,055,682 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GCCACTACAAGTTTTCTTAGCC -3'
(R):5'- ATGTCCTTGAAAAGCCAATGTG -3'

Sequencing Primer
(F):5'- ACTACAAGTTTTCTTAGCCATTGC -3'
(R):5'- GCTGGCAACCATCTGTAATG -3'
Posted On 2018-09-12