Incidental Mutation 'R6802:Irgq'
ID533379
Institutional Source Beutler Lab
Gene Symbol Irgq
Ensembl Gene ENSMUSG00000041037
Gene Nameimmunity-related GTPase family, Q
SynonymsFKSG27
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6802 (G1)
Quality Score175.009
Status Validated
Chromosome7
Chromosomal Location24530689-24538600 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24531651 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 89 (E89G)
Ref Sequence ENSEMBL: ENSMUSP00000036699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049020]
Predicted Effect probably benign
Transcript: ENSMUST00000049020
AA Change: E89G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036699
Gene: ENSMUSG00000041037
AA Change: E89G

DomainStartEndE-ValueType
SCOP:d4tmka_ 12 61 7e-3 SMART
low complexity region 64 75 N/A INTRINSIC
low complexity region 92 112 N/A INTRINSIC
low complexity region 132 145 N/A INTRINSIC
low complexity region 236 267 N/A INTRINSIC
low complexity region 409 455 N/A INTRINSIC
low complexity region 520 538 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,099,490 K38N probably damaging Het
Agap3 T A 5: 24,487,793 I408N possibly damaging Het
Apold1 G A 6: 134,983,730 R49H probably damaging Het
Apopt1 G T 12: 111,751,191 G162W probably benign Het
Arfgef1 A T 1: 10,189,452 M597K probably benign Het
Bsn C T 9: 108,110,624 probably benign Het
Ccdc177 A T 12: 80,759,283 D72E probably damaging Het
Ctdp1 A T 18: 80,420,441 probably null Het
Ctsj A T 13: 61,003,074 L190M probably benign Het
Dhx57 A G 17: 80,275,321 F285S probably benign Het
Dnah2 A T 11: 69,423,690 V4051E probably damaging Het
F5 A T 1: 164,179,356 D243V probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbxo30 G T 10: 11,291,480 G649C probably damaging Het
Focad T C 4: 88,274,203 S590P unknown Het
Focad G A 4: 88,344,684 V973I unknown Het
Glb1l3 T C 9: 26,859,352 probably null Het
Gli2 G A 1: 118,842,065 R586C probably damaging Het
Gm6401 T A 14: 41,966,917 E65V probably damaging Het
Gml2 T A 15: 74,824,246 L163H probably damaging Het
Grm6 A T 11: 50,853,389 Q229L probably benign Het
Gtf2h2 T C 13: 100,480,543 M252V probably benign Het
Hsf4 G A 8: 105,274,668 G309S probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Kcnj6 T C 16: 94,762,577 N354S probably benign Het
Lrguk A G 6: 34,062,457 H301R probably damaging Het
Mc4r C A 18: 66,859,417 M208I probably benign Het
Mrpl15 A G 1: 4,776,730 S208P probably benign Het
Neil2 A G 14: 63,191,814 F10S probably damaging Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1054 G T 2: 86,333,185 T57K possibly damaging Het
Olfr1186 A G 2: 88,525,597 T5A probably benign Het
Olfr360 A G 2: 37,068,415 M37V probably benign Het
Pacs1 T C 19: 5,152,784 I357V probably damaging Het
Pla2g15 T C 8: 106,150,581 L32P probably damaging Het
Pms1 A T 1: 53,206,792 S529R probably benign Het
Prkra A T 2: 76,633,537 D260E probably damaging Het
Qsox1 A C 1: 155,795,393 F127V probably damaging Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Robo1 T G 16: 72,933,313 V214G probably benign Het
Ryr2 G A 13: 11,686,966 A2935V probably damaging Het
Sgtb A T 13: 104,132,050 Q198L probably benign Het
Slc39a12 C T 2: 14,420,085 L376F probably benign Het
Socs1 C A 16: 10,784,358 V172L probably benign Het
Sprr2k A G 3: 92,433,364 probably benign Het
Tgm1 C T 14: 55,712,482 probably benign Het
Tph2 A T 10: 115,184,873 M6K probably damaging Het
Trav16 T A 14: 53,743,484 C43* probably null Het
Ttll5 A G 12: 85,879,386 E318G probably damaging Het
Vmn2r90 T A 17: 17,712,089 I86N probably damaging Het
Zdhhc19 T C 16: 32,506,358 S165P possibly damaging Het
Zfp352 A T 4: 90,225,200 T526S probably benign Het
Other mutations in Irgq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Irgq APN 7 24533724 missense probably damaging 1.00
IGL02639:Irgq APN 7 24531462 missense probably damaging 1.00
R4222:Irgq UTSW 7 24533625 missense possibly damaging 0.79
R4806:Irgq UTSW 7 24534045 missense probably damaging 1.00
R5831:Irgq UTSW 7 24533338 missense probably damaging 0.96
R5980:Irgq UTSW 7 24533345 missense probably damaging 1.00
R6460:Irgq UTSW 7 24533690 missense probably benign 0.00
R7173:Irgq UTSW 7 24533760 missense probably damaging 0.99
R7465:Irgq UTSW 7 24534409 missense probably damaging 0.97
R8350:Irgq UTSW 7 24533740 missense probably benign 0.00
R8409:Irgq UTSW 7 24533784 missense probably benign
R8470:Irgq UTSW 7 24534290 missense probably damaging 1.00
Z1176:Irgq UTSW 7 24531801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACACGGTAGAGATTCCC -3'
(R):5'- AGTTGGATCTAAGGCCACCC -3'

Sequencing Primer
(F):5'- CACGGTAGAGATTCCCGATGGAC -3'
(R):5'- TCTAGCTCCTCGCAGCG -3'
Posted On2018-09-12