Incidental Mutation 'R6802:1110004F10Rik'
ID 533381
Institutional Source Beutler Lab
Gene Symbol 1110004F10Rik
Ensembl Gene ENSMUSG00000030663
Gene Name RIKEN cDNA 1110004F10 gene
Synonyms sid2057
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock # R6802 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 116039397-116105210 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 116099490 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 38 (K38N)
Ref Sequence ENSEMBL: ENSMUSP00000116035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032899] [ENSMUST00000106607] [ENSMUST00000106608] [ENSMUST00000151254] [ENSMUST00000205427] [ENSMUST00000205450]
AlphaFold Q9R0P4
Predicted Effect probably damaging
Transcript: ENSMUST00000032899
AA Change: K38N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032899
Gene: ENSMUSG00000030663
AA Change: K38N

DomainStartEndE-ValueType
Pfam:SMAP 27 103 1.1e-17 PFAM
low complexity region 105 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106607
SMART Domains Protein: ENSMUSP00000102218
Gene: ENSMUSG00000030663

DomainStartEndE-ValueType
low complexity region 18 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106608
SMART Domains Protein: ENSMUSP00000102219
Gene: ENSMUSG00000030663

DomainStartEndE-ValueType
Pfam:SMAP 1 59 7.8e-10 PFAM
low complexity region 61 111 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151254
AA Change: K38N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116035
Gene: ENSMUSG00000030663
AA Change: K38N

DomainStartEndE-ValueType
Pfam:SMAP 26 79 4.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205427
Predicted Effect probably benign
Transcript: ENSMUST00000205450
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,487,793 I408N possibly damaging Het
Apold1 G A 6: 134,983,730 R49H probably damaging Het
Apopt1 G T 12: 111,751,191 G162W probably benign Het
Arfgef1 A T 1: 10,189,452 M597K probably benign Het
Bsn C T 9: 108,110,624 probably benign Het
Ccdc177 A T 12: 80,759,283 D72E probably damaging Het
Ctdp1 A T 18: 80,420,441 probably null Het
Ctsj A T 13: 61,003,074 L190M probably benign Het
Dhx57 A G 17: 80,275,321 F285S probably benign Het
Dnah2 A T 11: 69,423,690 V4051E probably damaging Het
F5 A T 1: 164,179,356 D243V probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbxo30 G T 10: 11,291,480 G649C probably damaging Het
Focad T C 4: 88,274,203 S590P unknown Het
Focad G A 4: 88,344,684 V973I unknown Het
Glb1l3 T C 9: 26,859,352 probably null Het
Gli2 G A 1: 118,842,065 R586C probably damaging Het
Gm6401 T A 14: 41,966,917 E65V probably damaging Het
Gml2 T A 15: 74,824,246 L163H probably damaging Het
Grm6 A T 11: 50,853,389 Q229L probably benign Het
Gtf2h2 T C 13: 100,480,543 M252V probably benign Het
Hsf4 G A 8: 105,274,668 G309S probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Irgq A G 7: 24,531,651 E89G probably benign Het
Kcnj6 T C 16: 94,762,577 N354S probably benign Het
Lrguk A G 6: 34,062,457 H301R probably damaging Het
Mc4r C A 18: 66,859,417 M208I probably benign Het
Mrpl15 A G 1: 4,776,730 S208P probably benign Het
Neil2 A G 14: 63,191,814 F10S probably damaging Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1054 G T 2: 86,333,185 T57K possibly damaging Het
Olfr1186 A G 2: 88,525,597 T5A probably benign Het
Olfr360 A G 2: 37,068,415 M37V probably benign Het
Pacs1 T C 19: 5,152,784 I357V probably damaging Het
Pla2g15 T C 8: 106,150,581 L32P probably damaging Het
Pms1 A T 1: 53,206,792 S529R probably benign Het
Prkra A T 2: 76,633,537 D260E probably damaging Het
Qsox1 A C 1: 155,795,393 F127V probably damaging Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Robo1 T G 16: 72,933,313 V214G probably benign Het
Ryr2 G A 13: 11,686,966 A2935V probably damaging Het
Sgtb A T 13: 104,132,050 Q198L probably benign Het
Slc39a12 C T 2: 14,420,085 L376F probably benign Het
Socs1 C A 16: 10,784,358 V172L probably benign Het
Sprr2k A G 3: 92,433,364 probably benign Het
Tgm1 C T 14: 55,712,482 probably benign Het
Tph2 A T 10: 115,184,873 M6K probably damaging Het
Trav16 T A 14: 53,743,484 C43* probably null Het
Ttll5 A G 12: 85,879,386 E318G probably damaging Het
Vmn2r90 T A 17: 17,712,089 I86N probably damaging Het
Zdhhc19 T C 16: 32,506,358 S165P possibly damaging Het
Zfp352 A T 4: 90,225,200 T526S probably benign Het
Other mutations in 1110004F10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2391:1110004F10Rik UTSW 7 116104226 missense probably damaging 0.99
R4789:1110004F10Rik UTSW 7 116093522 missense probably benign 0.03
R6249:1110004F10Rik UTSW 7 116103270 missense probably damaging 1.00
R7960:1110004F10Rik UTSW 7 116103246 missense possibly damaging 0.83
R8509:1110004F10Rik UTSW 7 116104434 missense possibly damaging 0.83
R9063:1110004F10Rik UTSW 7 116104425 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATTGACTTCTACAAACCACGAG -3'
(R):5'- TCTAACCACAATGCCAAAGGTG -3'

Sequencing Primer
(F):5'- CCACGAGTCCCAGTTAATTAAAAC -3'
(R):5'- AAACTGAAAGTGTTTGGTTAGGC -3'
Posted On 2018-09-12