Incidental Mutation 'R6802:Nrg1'
ID533382
Institutional Source Beutler Lab
Gene Symbol Nrg1
Ensembl Gene ENSMUSG00000062991
Gene Nameneuregulin 1
SynonymsD230005F13Rik, Hgl, GGF, HRGalpha, ARIA, 6030402G23Rik, HRG, GGFII, HGL, NDF, SMDF, heregulin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6802 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location31814551-32884029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31821264 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 476 (R476G)
Ref Sequence ENSEMBL: ENSMUSP00000146816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073884] [ENSMUST00000207417] [ENSMUST00000207470] [ENSMUST00000208205] [ENSMUST00000208488] [ENSMUST00000208497] [ENSMUST00000208598] [ENSMUST00000208617] [ENSMUST00000208819] [ENSMUST00000209107]
Predicted Effect probably damaging
Transcript: ENSMUST00000073884
AA Change: R476G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073546
Gene: ENSMUSG00000062991
AA Change: R476G

DomainStartEndE-ValueType
transmembrane domain 78 100 N/A INTRINSIC
low complexity region 180 198 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
EGF 236 277 7.88e-4 SMART
Pfam:Neuregulin 295 688 5.3e-193 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207417
AA Change: R413G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000207470
AA Change: R421G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000208205
AA Change: R416G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000208488
AA Change: R439G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000208497
AA Change: R476G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208598
AA Change: R416G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000208617
AA Change: R416G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000208819
Predicted Effect probably benign
Transcript: ENSMUST00000209107
AA Change: R428G

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit heart defects, impaired development of Schwann cell precursors, cranial ganglia, and radial glia cells, and die at embryonic day 10.5-11.5. Heterozygotes are hyperactive with reduced NMDA receptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,099,490 K38N probably damaging Het
Agap3 T A 5: 24,487,793 I408N possibly damaging Het
Apold1 G A 6: 134,983,730 R49H probably damaging Het
Apopt1 G T 12: 111,751,191 G162W probably benign Het
Arfgef1 A T 1: 10,189,452 M597K probably benign Het
Bsn C T 9: 108,110,624 probably benign Het
Ccdc177 A T 12: 80,759,283 D72E probably damaging Het
Ctdp1 A T 18: 80,420,441 probably null Het
Ctsj A T 13: 61,003,074 L190M probably benign Het
Dhx57 A G 17: 80,275,321 F285S probably benign Het
Dnah2 A T 11: 69,423,690 V4051E probably damaging Het
F5 A T 1: 164,179,356 D243V probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbxo30 G T 10: 11,291,480 G649C probably damaging Het
Focad T C 4: 88,274,203 S590P unknown Het
Focad G A 4: 88,344,684 V973I unknown Het
Glb1l3 T C 9: 26,859,352 probably null Het
Gli2 G A 1: 118,842,065 R586C probably damaging Het
Gm6401 T A 14: 41,966,917 E65V probably damaging Het
Gml2 T A 15: 74,824,246 L163H probably damaging Het
Grm6 A T 11: 50,853,389 Q229L probably benign Het
Gtf2h2 T C 13: 100,480,543 M252V probably benign Het
Hsf4 G A 8: 105,274,668 G309S probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Irgq A G 7: 24,531,651 E89G probably benign Het
Kcnj6 T C 16: 94,762,577 N354S probably benign Het
Lrguk A G 6: 34,062,457 H301R probably damaging Het
Mc4r C A 18: 66,859,417 M208I probably benign Het
Mrpl15 A G 1: 4,776,730 S208P probably benign Het
Neil2 A G 14: 63,191,814 F10S probably damaging Het
Olfr1054 G T 2: 86,333,185 T57K possibly damaging Het
Olfr1186 A G 2: 88,525,597 T5A probably benign Het
Olfr360 A G 2: 37,068,415 M37V probably benign Het
Pacs1 T C 19: 5,152,784 I357V probably damaging Het
Pla2g15 T C 8: 106,150,581 L32P probably damaging Het
Pms1 A T 1: 53,206,792 S529R probably benign Het
Prkra A T 2: 76,633,537 D260E probably damaging Het
Qsox1 A C 1: 155,795,393 F127V probably damaging Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Robo1 T G 16: 72,933,313 V214G probably benign Het
Ryr2 G A 13: 11,686,966 A2935V probably damaging Het
Sgtb A T 13: 104,132,050 Q198L probably benign Het
Slc39a12 C T 2: 14,420,085 L376F probably benign Het
Socs1 C A 16: 10,784,358 V172L probably benign Het
Sprr2k A G 3: 92,433,364 probably benign Het
Tgm1 C T 14: 55,712,482 probably benign Het
Tph2 A T 10: 115,184,873 M6K probably damaging Het
Trav16 T A 14: 53,743,484 C43* probably null Het
Ttll5 A G 12: 85,879,386 E318G probably damaging Het
Vmn2r90 T A 17: 17,712,089 I86N probably damaging Het
Zdhhc19 T C 16: 32,506,358 S165P possibly damaging Het
Zfp352 A T 4: 90,225,200 T526S probably benign Het
Other mutations in Nrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Nrg1 APN 8 31818089 missense probably damaging 0.99
IGL00500:Nrg1 APN 8 31822314 unclassified probably null
IGL01150:Nrg1 APN 8 31917875 missense probably damaging 1.00
IGL01998:Nrg1 APN 8 31918134 missense probably damaging 0.99
IGL02010:Nrg1 APN 8 31918143 missense probably benign 0.00
IGL02501:Nrg1 APN 8 31818263 unclassified probably null
IGL02741:Nrg1 APN 8 31822288 missense probably damaging 1.00
IGL02754:Nrg1 APN 8 31826363 splice site probably benign
IGL03056:Nrg1 APN 8 31821423 missense possibly damaging 0.93
IGL03121:Nrg1 APN 8 31824580 splice site probably benign
R6805_Nrg1_535 UTSW 8 31821264 missense probably damaging 1.00
R0533:Nrg1 UTSW 8 31831245 intron probably null
R1170:Nrg1 UTSW 8 31837667 splice site probably benign
R1405:Nrg1 UTSW 8 31917827 missense probably benign 0.16
R1405:Nrg1 UTSW 8 31917827 missense probably benign 0.16
R1486:Nrg1 UTSW 8 31818344 missense probably damaging 1.00
R1642:Nrg1 UTSW 8 31824508 missense probably benign 0.45
R1653:Nrg1 UTSW 8 31818653 missense probably damaging 1.00
R1762:Nrg1 UTSW 8 31822323 missense probably damaging 0.99
R1951:Nrg1 UTSW 8 31918193 missense probably damaging 1.00
R2060:Nrg1 UTSW 8 31918015 missense probably damaging 1.00
R2912:Nrg1 UTSW 8 31818567 missense probably damaging 1.00
R3786:Nrg1 UTSW 8 31821383 missense probably damaging 1.00
R4513:Nrg1 UTSW 8 32477077 intron probably benign
R4569:Nrg1 UTSW 8 31917774 missense probably benign 0.00
R4760:Nrg1 UTSW 8 31918200 nonsense probably null
R4769:Nrg1 UTSW 8 31917972 missense probably damaging 1.00
R4834:Nrg1 UTSW 8 31917719 missense probably benign
R5058:Nrg1 UTSW 8 31824559 missense probably damaging 1.00
R5230:Nrg1 UTSW 8 31818479 missense probably damaging 0.99
R5443:Nrg1 UTSW 8 31849320 missense probably damaging 1.00
R5479:Nrg1 UTSW 8 31818377 missense probably damaging 1.00
R5940:Nrg1 UTSW 8 31849344 missense probably damaging 0.99
R6010:Nrg1 UTSW 8 31818572 missense probably damaging 1.00
R6170:Nrg1 UTSW 8 31818480 missense probably damaging 1.00
R6379:Nrg1 UTSW 8 32883721 start gained probably benign
R6460:Nrg1 UTSW 8 31818533 missense probably damaging 1.00
R6750:Nrg1 UTSW 8 31818096 missense probably damaging 1.00
R6767:Nrg1 UTSW 8 31917895 missense probably damaging 1.00
R6804:Nrg1 UTSW 8 31821264 missense probably damaging 1.00
R6805:Nrg1 UTSW 8 31821264 missense probably damaging 1.00
R6848:Nrg1 UTSW 8 31818056 missense probably damaging 1.00
R6930:Nrg1 UTSW 8 31818506 missense probably damaging 1.00
R6963:Nrg1 UTSW 8 31917662 missense probably benign 0.04
R7070:Nrg1 UTSW 8 31849437 missense probably damaging 0.99
R7176:Nrg1 UTSW 8 31968036 nonsense probably null
R7490:Nrg1 UTSW 8 31818654 missense probably damaging 1.00
R7526:Nrg1 UTSW 8 31818323 missense probably benign 0.00
R7664:Nrg1 UTSW 8 32009141 utr 5 prime probably null
R7881:Nrg1 UTSW 8 31838324 nonsense probably null
R7964:Nrg1 UTSW 8 31838324 nonsense probably null
R8013:Nrg1 UTSW 8 31949923 missense probably benign 0.41
Z1088:Nrg1 UTSW 8 31918005 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GCTGGCCGATTGGAATTAGATG -3'
(R):5'- AGCTGGAGTAATGGGCACAC -3'

Sequencing Primer
(F):5'- TACACCTGAAGGCTCCTGC -3'
(R):5'- TGGGCACACAGAAAGCATCATTTC -3'
Posted On2018-09-12