Incidental Mutation 'R6802:Ttll5'
ID533392
Institutional Source Beutler Lab
Gene Symbol Ttll5
Ensembl Gene ENSMUSG00000012609
Gene Nametubulin tyrosine ligase-like family, member 5
SynonymsSTAMP
MMRRC Submission
Accession Numbers

Genbank: NM_001081423

Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R6802 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location85824659-86061893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85879386 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 318 (E318G)
Ref Sequence ENSEMBL: ENSMUSP00000135395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040179] [ENSMUST00000040273] [ENSMUST00000095536] [ENSMUST00000110220] [ENSMUST00000110224] [ENSMUST00000155448] [ENSMUST00000176695] [ENSMUST00000177114]
Predicted Effect probably damaging
Transcript: ENSMUST00000040179
AA Change: E318G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048809
Gene: ENSMUSG00000012609
AA Change: E318G

DomainStartEndE-ValueType
Pfam:TTL 110 407 1.9e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000040273
AA Change: E318G

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039939
Gene: ENSMUSG00000012609
AA Change: E318G

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095536
AA Change: E318G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093192
Gene: ENSMUSG00000012609
AA Change: E318G

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.2e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110220
AA Change: E318G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105849
Gene: ENSMUSG00000012609
AA Change: E318G

DomainStartEndE-ValueType
Pfam:TTL 110 348 3.5e-72 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110224
AA Change: E318G

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105853
Gene: ENSMUSG00000012609
AA Change: E318G

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 543 562 N/A INTRINSIC
low complexity region 582 608 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 768 780 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155448
AA Change: E318G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134971
Gene: ENSMUSG00000012609
AA Change: E318G

DomainStartEndE-ValueType
Pfam:TTL 110 407 6.4e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176695
AA Change: E318G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135852
Gene: ENSMUSG00000012609
AA Change: E318G

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177114
AA Change: E318G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135395
Gene: ENSMUSG00000012609
AA Change: E318G

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Meta Mutation Damage Score 0.6097 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubulin tyrosine ligase like protein family. This protein interacts with two glucocorticoid receptor coactivators, transcriptional intermediary factor 2 and steroid receptor coactivator 1. This protein may function as a coregulator of glucocorticoid receptor mediated gene induction and repression. This protein may also function as an alpha tubulin polyglutamylase.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility associated with abnormal sperm morphology and reduced tubulin polyglutamylation in the spermatozoa. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(3) Gene trapped(4)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,099,490 K38N probably damaging Het
Agap3 T A 5: 24,487,793 I408N possibly damaging Het
Apold1 G A 6: 134,983,730 R49H probably damaging Het
Apopt1 G T 12: 111,751,191 G162W probably benign Het
Arfgef1 A T 1: 10,189,452 M597K probably benign Het
Bsn C T 9: 108,110,624 probably benign Het
Ccdc177 A T 12: 80,759,283 D72E probably damaging Het
Ctdp1 A T 18: 80,420,441 probably null Het
Ctsj A T 13: 61,003,074 L190M probably benign Het
Dhx57 A G 17: 80,275,321 F285S probably benign Het
Dnah2 A T 11: 69,423,690 V4051E probably damaging Het
F5 A T 1: 164,179,356 D243V probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbxo30 G T 10: 11,291,480 G649C probably damaging Het
Focad T C 4: 88,274,203 S590P unknown Het
Focad G A 4: 88,344,684 V973I unknown Het
Glb1l3 T C 9: 26,859,352 probably null Het
Gli2 G A 1: 118,842,065 R586C probably damaging Het
Gm6401 T A 14: 41,966,917 E65V probably damaging Het
Gml2 T A 15: 74,824,246 L163H probably damaging Het
Grm6 A T 11: 50,853,389 Q229L probably benign Het
Gtf2h2 T C 13: 100,480,543 M252V probably benign Het
Hsf4 G A 8: 105,274,668 G309S probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Irgq A G 7: 24,531,651 E89G probably benign Het
Kcnj6 T C 16: 94,762,577 N354S probably benign Het
Lrguk A G 6: 34,062,457 H301R probably damaging Het
Mc4r C A 18: 66,859,417 M208I probably benign Het
Mrpl15 A G 1: 4,776,730 S208P probably benign Het
Neil2 A G 14: 63,191,814 F10S probably damaging Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1054 G T 2: 86,333,185 T57K possibly damaging Het
Olfr1186 A G 2: 88,525,597 T5A probably benign Het
Olfr360 A G 2: 37,068,415 M37V probably benign Het
Pacs1 T C 19: 5,152,784 I357V probably damaging Het
Pla2g15 T C 8: 106,150,581 L32P probably damaging Het
Pms1 A T 1: 53,206,792 S529R probably benign Het
Prkra A T 2: 76,633,537 D260E probably damaging Het
Qsox1 A C 1: 155,795,393 F127V probably damaging Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Robo1 T G 16: 72,933,313 V214G probably benign Het
Ryr2 G A 13: 11,686,966 A2935V probably damaging Het
Sgtb A T 13: 104,132,050 Q198L probably benign Het
Slc39a12 C T 2: 14,420,085 L376F probably benign Het
Socs1 C A 16: 10,784,358 V172L probably benign Het
Sprr2k A G 3: 92,433,364 probably benign Het
Tgm1 C T 14: 55,712,482 probably benign Het
Tph2 A T 10: 115,184,873 M6K probably damaging Het
Trav16 T A 14: 53,743,484 C43* probably null Het
Vmn2r90 T A 17: 17,712,089 I86N probably damaging Het
Zdhhc19 T C 16: 32,506,358 S165P possibly damaging Het
Zfp352 A T 4: 90,225,200 T526S probably benign Het
Other mutations in Ttll5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Ttll5 APN 12 85843826 missense probably damaging 1.00
IGL00932:Ttll5 APN 12 85929907 missense probably damaging 1.00
IGL00964:Ttll5 APN 12 85849283 missense possibly damaging 0.78
IGL00978:Ttll5 APN 12 85933482 nonsense probably null
IGL00990:Ttll5 APN 12 85876589 missense probably damaging 1.00
IGL01726:Ttll5 APN 12 85918934 missense probably benign 0.30
IGL01797:Ttll5 APN 12 85956597 missense possibly damaging 0.54
IGL02008:Ttll5 APN 12 85933611 missense probably damaging 1.00
IGL02210:Ttll5 APN 12 85912545 intron probably benign
IGL02979:Ttll5 APN 12 85826582 missense probably damaging 1.00
IGL03079:Ttll5 APN 12 85876558 missense probably damaging 1.00
IGL03149:Ttll5 APN 12 85918984 missense probably damaging 0.98
G4846:Ttll5 UTSW 12 86024244 missense probably damaging 0.99
PIT4812001:Ttll5 UTSW 12 85926861 missense probably benign 0.12
R0045:Ttll5 UTSW 12 85879359 splice site probably benign
R0153:Ttll5 UTSW 12 85831966 missense probably damaging 1.00
R0282:Ttll5 UTSW 12 85996053 missense probably benign 0.12
R0318:Ttll5 UTSW 12 85876594 critical splice donor site probably null
R0465:Ttll5 UTSW 12 85933326 missense probably benign 0.42
R0540:Ttll5 UTSW 12 85933676 critical splice donor site probably null
R1086:Ttll5 UTSW 12 85891079 missense possibly damaging 0.66
R1467:Ttll5 UTSW 12 85918962 splice site probably null
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1505:Ttll5 UTSW 12 85879410 missense probably damaging 1.00
R1524:Ttll5 UTSW 12 85864568 nonsense probably null
R1540:Ttll5 UTSW 12 85892208 nonsense probably null
R1598:Ttll5 UTSW 12 85863598 missense probably damaging 0.98
R1649:Ttll5 UTSW 12 85923014 missense probably damaging 1.00
R1774:Ttll5 UTSW 12 85933402 missense probably benign 0.09
R2340:Ttll5 UTSW 12 85892148 missense probably benign 0.02
R4049:Ttll5 UTSW 12 86012799 missense probably benign 0.01
R4094:Ttll5 UTSW 12 85956602 nonsense probably null
R4095:Ttll5 UTSW 12 85956602 nonsense probably null
R4908:Ttll5 UTSW 12 85919174 missense probably benign 0.31
R5012:Ttll5 UTSW 12 85926844 missense possibly damaging 0.93
R5137:Ttll5 UTSW 12 85923045 missense possibly damaging 0.83
R5416:Ttll5 UTSW 12 86012828 missense possibly damaging 0.77
R5773:Ttll5 UTSW 12 85933555 frame shift probably null
R5774:Ttll5 UTSW 12 85933555 frame shift probably null
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6173:Ttll5 UTSW 12 85933377 missense probably damaging 0.99
R6343:Ttll5 UTSW 12 85956699 missense probably benign 0.00
R6449:Ttll5 UTSW 12 86024276 missense probably benign 0.00
R6750:Ttll5 UTSW 12 85956610 missense probably damaging 0.98
R6825:Ttll5 UTSW 12 85883328 splice site probably null
R6955:Ttll5 UTSW 12 85864579 missense possibly damaging 0.91
R7098:Ttll5 UTSW 12 85917673 critical splice acceptor site probably null
R7154:Ttll5 UTSW 12 85925764 missense probably damaging 0.98
R7215:Ttll5 UTSW 12 85933396 missense probably benign 0.02
R7339:Ttll5 UTSW 12 85857464 critical splice donor site probably null
R7520:Ttll5 UTSW 12 85899471 missense probably damaging 1.00
R7728:Ttll5 UTSW 12 85956632 missense probably benign 0.02
R7894:Ttll5 UTSW 12 85889174 missense probably damaging 1.00
R8119:Ttll5 UTSW 12 86020548 missense probably damaging 0.98
R8129:Ttll5 UTSW 12 85891084 critical splice donor site probably null
R8200:Ttll5 UTSW 12 85879410 missense probably damaging 1.00
R8357:Ttll5 UTSW 12 85876578 missense probably damaging 1.00
R8413:Ttll5 UTSW 12 85919121 missense probably benign 0.00
R8457:Ttll5 UTSW 12 85876578 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGCAGTCTGTACCTTCTG -3'
(R):5'- CTGGAGAAATCACTATGCCCC -3'

Sequencing Primer
(F):5'- AGTCTGTACCTTCTGCACGGG -3'
(R):5'- TATGCCCCACTAGCTGAGGATC -3'
Posted On2018-09-12