Incidental Mutation 'R6802:Ctsj'
ID533395
Institutional Source Beutler Lab
Gene Symbol Ctsj
Ensembl Gene ENSMUSG00000055298
Gene Namecathepsin J
SynonymsCatRLP, rat gene/Cathepsin L-related protein, Cat P, CATP, Ctsp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6802 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location61000179-61005959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61003074 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 190 (L190M)
Ref Sequence ENSEMBL: ENSMUSP00000071457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071526] [ENSMUST00000224224]
Predicted Effect probably benign
Transcript: ENSMUST00000071526
AA Change: L190M

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071457
Gene: ENSMUSG00000055298
AA Change: L190M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Inhibitor_I29 29 87 1.18e-21 SMART
Pept_C1 113 331 3.3e-109 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224224
AA Change: L191M

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,099,490 K38N probably damaging Het
Agap3 T A 5: 24,487,793 I408N possibly damaging Het
Apold1 G A 6: 134,983,730 R49H probably damaging Het
Apopt1 G T 12: 111,751,191 G162W probably benign Het
Arfgef1 A T 1: 10,189,452 M597K probably benign Het
Bsn C T 9: 108,110,624 probably benign Het
Ccdc177 A T 12: 80,759,283 D72E probably damaging Het
Ctdp1 A T 18: 80,420,441 probably null Het
Dhx57 A G 17: 80,275,321 F285S probably benign Het
Dnah2 A T 11: 69,423,690 V4051E probably damaging Het
F5 A T 1: 164,179,356 D243V probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbxo30 G T 10: 11,291,480 G649C probably damaging Het
Focad T C 4: 88,274,203 S590P unknown Het
Focad G A 4: 88,344,684 V973I unknown Het
Glb1l3 T C 9: 26,859,352 probably null Het
Gli2 G A 1: 118,842,065 R586C probably damaging Het
Gm6401 T A 14: 41,966,917 E65V probably damaging Het
Gml2 T A 15: 74,824,246 L163H probably damaging Het
Grm6 A T 11: 50,853,389 Q229L probably benign Het
Gtf2h2 T C 13: 100,480,543 M252V probably benign Het
Hsf4 G A 8: 105,274,668 G309S probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Irgq A G 7: 24,531,651 E89G probably benign Het
Kcnj6 T C 16: 94,762,577 N354S probably benign Het
Lrguk A G 6: 34,062,457 H301R probably damaging Het
Mc4r C A 18: 66,859,417 M208I probably benign Het
Mrpl15 A G 1: 4,776,730 S208P probably benign Het
Neil2 A G 14: 63,191,814 F10S probably damaging Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1054 G T 2: 86,333,185 T57K possibly damaging Het
Olfr1186 A G 2: 88,525,597 T5A probably benign Het
Olfr360 A G 2: 37,068,415 M37V probably benign Het
Pacs1 T C 19: 5,152,784 I357V probably damaging Het
Pla2g15 T C 8: 106,150,581 L32P probably damaging Het
Pms1 A T 1: 53,206,792 S529R probably benign Het
Prkra A T 2: 76,633,537 D260E probably damaging Het
Qsox1 A C 1: 155,795,393 F127V probably damaging Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Robo1 T G 16: 72,933,313 V214G probably benign Het
Ryr2 G A 13: 11,686,966 A2935V probably damaging Het
Sgtb A T 13: 104,132,050 Q198L probably benign Het
Slc39a12 C T 2: 14,420,085 L376F probably benign Het
Socs1 C A 16: 10,784,358 V172L probably benign Het
Sprr2k A G 3: 92,433,364 probably benign Het
Tgm1 C T 14: 55,712,482 probably benign Het
Tph2 A T 10: 115,184,873 M6K probably damaging Het
Trav16 T A 14: 53,743,484 C43* probably null Het
Ttll5 A G 12: 85,879,386 E318G probably damaging Het
Vmn2r90 T A 17: 17,712,089 I86N probably damaging Het
Zdhhc19 T C 16: 32,506,358 S165P possibly damaging Het
Zfp352 A T 4: 90,225,200 T526S probably benign Het
Other mutations in Ctsj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ctsj APN 13 61001418 missense possibly damaging 0.66
IGL02199:Ctsj APN 13 61002537 missense probably damaging 0.99
IGL02630:Ctsj APN 13 61001400 missense probably damaging 1.00
IGL02809:Ctsj APN 13 61003160 missense probably damaging 1.00
IGL03066:Ctsj APN 13 61004488 missense possibly damaging 0.49
IGL02799:Ctsj UTSW 13 61003820 missense probably benign 0.01
PIT4581001:Ctsj UTSW 13 61002556 missense probably damaging 1.00
R0094:Ctsj UTSW 13 61003705 critical splice donor site probably null
R0586:Ctsj UTSW 13 61003701 splice site probably benign
R0841:Ctsj UTSW 13 61002543 missense probably damaging 0.98
R1145:Ctsj UTSW 13 61002543 missense probably damaging 0.98
R1145:Ctsj UTSW 13 61002543 missense probably damaging 0.98
R1146:Ctsj UTSW 13 61002498 missense probably benign 0.07
R1146:Ctsj UTSW 13 61002498 missense probably benign 0.07
R2201:Ctsj UTSW 13 61002549 missense probably damaging 1.00
R2402:Ctsj UTSW 13 61000574 missense probably damaging 1.00
R5081:Ctsj UTSW 13 61003850 missense possibly damaging 0.94
R5325:Ctsj UTSW 13 61004025 missense possibly damaging 0.93
R5416:Ctsj UTSW 13 61004523 missense probably damaging 1.00
R5776:Ctsj UTSW 13 61003142 missense probably damaging 1.00
R7072:Ctsj UTSW 13 61003083 nonsense probably null
R7331:Ctsj UTSW 13 61003831 missense probably benign
R7386:Ctsj UTSW 13 61000559 missense possibly damaging 0.74
R7853:Ctsj UTSW 13 61004070 missense probably damaging 1.00
R7936:Ctsj UTSW 13 61004070 missense probably damaging 1.00
Z1176:Ctsj UTSW 13 61004115 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAGAAGCTATTTAGTGTCTG -3'
(R):5'- TCCTGACAGGGTAAATGTGGC -3'

Sequencing Primer
(F):5'- CAGGCATTGTAATGAAAGCAATTGC -3'
(R):5'- ACAGGGTAAATGTGGCTCTTG -3'
Posted On2018-09-12