Incidental Mutation 'R6802:Gtf2h2'
ID533396
Institutional Source Beutler Lab
Gene Symbol Gtf2h2
Ensembl Gene ENSMUSG00000021639
Gene Namegeneral transcription factor II H, polypeptide 2
Synonymsbasal transcription factor 2, p44 subunit, 44kDa, p44, Btf2p44
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6802 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location100460218-100492579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100480543 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 252 (M252V)
Ref Sequence ENSEMBL: ENSMUSP00000065228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066984] [ENSMUST00000134842] [ENSMUST00000145266]
Predicted Effect probably benign
Transcript: ENSMUST00000066984
AA Change: M252V

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065228
Gene: ENSMUSG00000021639
AA Change: M252V

DomainStartEndE-ValueType
VWA 58 240 1.02e-14 SMART
Blast:BIR 291 310 6e-7 BLAST
C1_4 345 388 3.13e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134842
SMART Domains Protein: ENSMUSP00000138748
Gene: ENSMUSG00000021639

DomainStartEndE-ValueType
Pfam:Ssl1 64 139 2.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145266
AA Change: M252V

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138108
Gene: ENSMUSG00000021639
AA Change: M252V

DomainStartEndE-ValueType
VWA 58 240 1.02e-14 SMART
Blast:BIR 291 310 6e-7 BLAST
C1_4 345 388 3.13e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232450
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This gene is within the telomeric copy of the duplication. Deletion of this gene sometimes accompanies deletion of the neighboring SMN1 gene in spinal muscular atrophy (SMA) patients but it is unclear if deletion of this gene contributes to the SMA phenotype. This gene encodes the 44 kDa subunit of RNA polymerase II transcription initiation factor IIH which is involved in basal transcription and nucleotide excision repair. Transcript variants for this gene have been described, but their full length nature has not been determined. A second copy of this gene within the centromeric copy of the duplication has been described in the literature. It is reported to be different by either two or four base pairs; however, no sequence data is currently available for the centromeric copy of the gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,099,490 K38N probably damaging Het
Agap3 T A 5: 24,487,793 I408N possibly damaging Het
Apold1 G A 6: 134,983,730 R49H probably damaging Het
Apopt1 G T 12: 111,751,191 G162W probably benign Het
Arfgef1 A T 1: 10,189,452 M597K probably benign Het
Bsn C T 9: 108,110,624 probably benign Het
Ccdc177 A T 12: 80,759,283 D72E probably damaging Het
Ctdp1 A T 18: 80,420,441 probably null Het
Ctsj A T 13: 61,003,074 L190M probably benign Het
Dhx57 A G 17: 80,275,321 F285S probably benign Het
Dnah2 A T 11: 69,423,690 V4051E probably damaging Het
F5 A T 1: 164,179,356 D243V probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbxo30 G T 10: 11,291,480 G649C probably damaging Het
Focad T C 4: 88,274,203 S590P unknown Het
Focad G A 4: 88,344,684 V973I unknown Het
Glb1l3 T C 9: 26,859,352 probably null Het
Gli2 G A 1: 118,842,065 R586C probably damaging Het
Gm6401 T A 14: 41,966,917 E65V probably damaging Het
Gml2 T A 15: 74,824,246 L163H probably damaging Het
Grm6 A T 11: 50,853,389 Q229L probably benign Het
Hsf4 G A 8: 105,274,668 G309S probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Irgq A G 7: 24,531,651 E89G probably benign Het
Kcnj6 T C 16: 94,762,577 N354S probably benign Het
Lrguk A G 6: 34,062,457 H301R probably damaging Het
Mc4r C A 18: 66,859,417 M208I probably benign Het
Mrpl15 A G 1: 4,776,730 S208P probably benign Het
Neil2 A G 14: 63,191,814 F10S probably damaging Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1054 G T 2: 86,333,185 T57K possibly damaging Het
Olfr1186 A G 2: 88,525,597 T5A probably benign Het
Olfr360 A G 2: 37,068,415 M37V probably benign Het
Pacs1 T C 19: 5,152,784 I357V probably damaging Het
Pla2g15 T C 8: 106,150,581 L32P probably damaging Het
Pms1 A T 1: 53,206,792 S529R probably benign Het
Prkra A T 2: 76,633,537 D260E probably damaging Het
Qsox1 A C 1: 155,795,393 F127V probably damaging Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Robo1 T G 16: 72,933,313 V214G probably benign Het
Ryr2 G A 13: 11,686,966 A2935V probably damaging Het
Sgtb A T 13: 104,132,050 Q198L probably benign Het
Slc39a12 C T 2: 14,420,085 L376F probably benign Het
Socs1 C A 16: 10,784,358 V172L probably benign Het
Sprr2k A G 3: 92,433,364 probably benign Het
Tgm1 C T 14: 55,712,482 probably benign Het
Tph2 A T 10: 115,184,873 M6K probably damaging Het
Trav16 T A 14: 53,743,484 C43* probably null Het
Ttll5 A G 12: 85,879,386 E318G probably damaging Het
Vmn2r90 T A 17: 17,712,089 I86N probably damaging Het
Zdhhc19 T C 16: 32,506,358 S165P possibly damaging Het
Zfp352 A T 4: 90,225,200 T526S probably benign Het
Other mutations in Gtf2h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gtf2h2 APN 13 100480998 unclassified probably benign
IGL00780:Gtf2h2 APN 13 100479221 missense probably benign 0.01
IGL01475:Gtf2h2 APN 13 100481033 missense probably damaging 1.00
IGL02298:Gtf2h2 APN 13 100481039 missense probably damaging 1.00
IGL02754:Gtf2h2 APN 13 100481239 missense probably damaging 1.00
R0602:Gtf2h2 UTSW 13 100469025 missense probably benign 0.03
R0621:Gtf2h2 UTSW 13 100488925 missense probably damaging 1.00
R0665:Gtf2h2 UTSW 13 100481054 missense probably damaging 1.00
R4709:Gtf2h2 UTSW 13 100469015 nonsense probably null
R4810:Gtf2h2 UTSW 13 100481002 critical splice donor site probably null
R5262:Gtf2h2 UTSW 13 100481848 unclassified probably benign
R5548:Gtf2h2 UTSW 13 100481036 missense possibly damaging 0.92
R5741:Gtf2h2 UTSW 13 100480558 missense probably benign 0.00
R7256:Gtf2h2 UTSW 13 100479201 missense probably benign 0.05
R8355:Gtf2h2 UTSW 13 100468995 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTATCAACAAACAGGATAGGTGGC -3'
(R):5'- TGCAAGGAGTTCTCAATAGGTCAG -3'

Sequencing Primer
(F):5'- CAAACAGGATAGGTGGCTTTAATTTC -3'
(R):5'- CTTTCAAAAAGGTAGCAATCTCACTC -3'
Posted On2018-09-12