Incidental Mutation 'R6802:Pacs1'
ID 533412
Institutional Source Beutler Lab
Gene Symbol Pacs1
Ensembl Gene ENSMUSG00000024855
Gene Name phosphofurin acidic cluster sorting protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6802 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 5133688-5273119 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 5152784 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 357 (I357V)
Ref Sequence ENSEMBL: ENSMUSP00000025786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025786]
AlphaFold Q8K212
Predicted Effect probably damaging
Transcript: ENSMUST00000025786
AA Change: I357V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855
AA Change: I357V

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 27 46 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Pacs-1 546 958 2e-193 PFAM
Meta Mutation Damage Score 0.0699 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,099,490 K38N probably damaging Het
Agap3 T A 5: 24,487,793 I408N possibly damaging Het
Apold1 G A 6: 134,983,730 R49H probably damaging Het
Apopt1 G T 12: 111,751,191 G162W probably benign Het
Arfgef1 A T 1: 10,189,452 M597K probably benign Het
Bsn C T 9: 108,110,624 probably benign Het
Ccdc177 A T 12: 80,759,283 D72E probably damaging Het
Ctdp1 A T 18: 80,420,441 probably null Het
Ctsj A T 13: 61,003,074 L190M probably benign Het
Dhx57 A G 17: 80,275,321 F285S probably benign Het
Dnah2 A T 11: 69,423,690 V4051E probably damaging Het
F5 A T 1: 164,179,356 D243V probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbxo30 G T 10: 11,291,480 G649C probably damaging Het
Focad T C 4: 88,274,203 S590P unknown Het
Focad G A 4: 88,344,684 V973I unknown Het
Glb1l3 T C 9: 26,859,352 probably null Het
Gli2 G A 1: 118,842,065 R586C probably damaging Het
Gm6401 T A 14: 41,966,917 E65V probably damaging Het
Gml2 T A 15: 74,824,246 L163H probably damaging Het
Grm6 A T 11: 50,853,389 Q229L probably benign Het
Gtf2h2 T C 13: 100,480,543 M252V probably benign Het
Hsf4 G A 8: 105,274,668 G309S probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Irgq A G 7: 24,531,651 E89G probably benign Het
Kcnj6 T C 16: 94,762,577 N354S probably benign Het
Lrguk A G 6: 34,062,457 H301R probably damaging Het
Mc4r C A 18: 66,859,417 M208I probably benign Het
Mrpl15 A G 1: 4,776,730 S208P probably benign Het
Neil2 A G 14: 63,191,814 F10S probably damaging Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1054 G T 2: 86,333,185 T57K possibly damaging Het
Olfr1186 A G 2: 88,525,597 T5A probably benign Het
Olfr360 A G 2: 37,068,415 M37V probably benign Het
Pla2g15 T C 8: 106,150,581 L32P probably damaging Het
Pms1 A T 1: 53,206,792 S529R probably benign Het
Prkra A T 2: 76,633,537 D260E probably damaging Het
Qsox1 A C 1: 155,795,393 F127V probably damaging Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Robo1 T G 16: 72,933,313 V214G probably benign Het
Ryr2 G A 13: 11,686,966 A2935V probably damaging Het
Sgtb A T 13: 104,132,050 Q198L probably benign Het
Slc39a12 C T 2: 14,420,085 L376F probably benign Het
Socs1 C A 16: 10,784,358 V172L probably benign Het
Sprr2k A G 3: 92,433,364 probably benign Het
Tgm1 C T 14: 55,712,482 probably benign Het
Tph2 A T 10: 115,184,873 M6K probably damaging Het
Trav16 T A 14: 53,743,484 C43* probably null Het
Ttll5 A G 12: 85,879,386 E318G probably damaging Het
Vmn2r90 T A 17: 17,712,089 I86N probably damaging Het
Zdhhc19 T C 16: 32,506,358 S165P possibly damaging Het
Zfp352 A T 4: 90,225,200 T526S probably benign Het
Other mutations in Pacs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pacs1 APN 19 5153698 missense probably damaging 0.98
IGL01335:Pacs1 APN 19 5142632 missense probably damaging 1.00
IGL01717:Pacs1 APN 19 5167972 missense probably damaging 1.00
IGL02453:Pacs1 APN 19 5135005 missense probably damaging 1.00
IGL02887:Pacs1 APN 19 5135110 splice site probably benign
Batavian UTSW 19 5156413 missense possibly damaging 0.71
chicory UTSW 19 5139297 missense probably benign 0.33
endive UTSW 19 5272583 nonsense probably null
Escarole UTSW 19 5156356 critical splice donor site probably null
frisee UTSW 19 5136791 missense probably damaging 1.00
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0316:Pacs1 UTSW 19 5135121 splice site silent
R0369:Pacs1 UTSW 19 5141698 missense probably damaging 1.00
R0443:Pacs1 UTSW 19 5272583 nonsense probably null
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0974:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R1202:Pacs1 UTSW 19 5135237 missense probably damaging 1.00
R1672:Pacs1 UTSW 19 5152309 missense probably benign 0.00
R1689:Pacs1 UTSW 19 5272615 unclassified probably benign
R1842:Pacs1 UTSW 19 5155884 missense probably damaging 0.96
R1847:Pacs1 UTSW 19 5153714 missense probably damaging 0.99
R3884:Pacs1 UTSW 19 5155759 missense probably damaging 0.99
R4577:Pacs1 UTSW 19 5143833 nonsense probably null
R4630:Pacs1 UTSW 19 5156356 critical splice donor site probably null
R5029:Pacs1 UTSW 19 5142271 missense probably benign 0.03
R5198:Pacs1 UTSW 19 5139297 missense probably benign 0.33
R5223:Pacs1 UTSW 19 5145141 missense probably benign 0.00
R5464:Pacs1 UTSW 19 5147207 missense probably benign
R5695:Pacs1 UTSW 19 5136791 missense probably damaging 1.00
R6128:Pacs1 UTSW 19 5152372 splice site probably null
R6335:Pacs1 UTSW 19 5159977 missense probably damaging 1.00
R6831:Pacs1 UTSW 19 5160795 missense probably damaging 1.00
R7071:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R7200:Pacs1 UTSW 19 5156413 missense possibly damaging 0.71
R7248:Pacs1 UTSW 19 5138975 missense probably damaging 1.00
R7576:Pacs1 UTSW 19 5145120 missense probably benign 0.09
R7682:Pacs1 UTSW 19 5152699 missense probably damaging 0.99
R7715:Pacs1 UTSW 19 5141681 missense probably benign 0.01
R7738:Pacs1 UTSW 19 5152350 missense probably benign 0.11
R8339:Pacs1 UTSW 19 5142623 missense probably damaging 1.00
R8930:Pacs1 UTSW 19 5135002 missense probably damaging 1.00
R8932:Pacs1 UTSW 19 5135002 missense probably damaging 1.00
R9043:Pacs1 UTSW 19 5138936 missense probably benign 0.23
R9211:Pacs1 UTSW 19 5139029 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGTCCTCTGAGTGAATGAGAGAG -3'
(R):5'- TTGGTCTAGAGGGACAGTGC -3'

Sequencing Primer
(F):5'- CTCTGAGTGAATGAGAGAGGAGGC -3'
(R):5'- CTAGAGGGACAGTGCTGCATGTC -3'
Posted On 2018-09-12