Incidental Mutation 'R6803:Cpt2'
ID533425
Institutional Source Beutler Lab
Gene Symbol Cpt2
Ensembl Gene ENSMUSG00000028607
Gene Namecarnitine palmitoyltransferase 2
SynonymsCPT II, CPTII
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R6803 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location107903981-107923610 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107912664 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 79 (N79S)
Ref Sequence ENSEMBL: ENSMUSP00000114362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030345] [ENSMUST00000106719] [ENSMUST00000106720] [ENSMUST00000131644]
Predicted Effect probably benign
Transcript: ENSMUST00000030345
AA Change: N106S

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030345
Gene: ENSMUSG00000028607
AA Change: N106S

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 49 648 1.4e-190 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106719
AA Change: N106S

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102330
Gene: ENSMUSG00000028607
AA Change: N106S

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 48 265 1.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106720
AA Change: N106S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102331
Gene: ENSMUSG00000028607
AA Change: N106S

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 48 113 2.1e-21 PFAM
Pfam:Carn_acyltransf 101 214 1.9e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131644
AA Change: N79S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114362
Gene: ENSMUSG00000028607
AA Change: N79S

DomainStartEndE-ValueType
PDB:4EYW|B 27 88 2e-28 PDB
Meta Mutation Damage Score 0.1573 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 94.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein which is transported to the mitochondrial inner membrane. Together with carnitine palmitoyltransferase I, the encoded protein oxidizes long-chain fatty acids in the mitochondria. Defects in this gene are associated with mitochondrial long-chain fatty-acid (LCFA) oxidation disorders. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg9 A C 9: 50,789,560 D210A probably benign Het
As3mt T G 19: 46,709,581 M120R probably benign Het
Baz1a T A 12: 54,941,555 S270C probably null Het
Car5a A C 8: 121,923,765 probably null Het
Ccdc187 T A 2: 26,289,779 T223S probably benign Het
Cel T C 2: 28,558,048 N322S probably benign Het
Chd6 T C 2: 160,960,359 E2185G possibly damaging Het
Clcnkb T C 4: 141,405,328 T597A probably benign Het
Cntnap1 A G 11: 101,177,234 Y24C possibly damaging Het
Cog3 A G 14: 75,704,039 S817P probably benign Het
Col8a2 A G 4: 126,312,000 Y601C probably damaging Het
Cpm G T 10: 117,676,097 probably null Het
Dnah17 T C 11: 118,125,372 T314A probably benign Het
Dnm1 C A 2: 32,312,754 V46F probably damaging Het
Fat3 C T 9: 15,996,787 V2640M probably damaging Het
Fbxl2 A T 9: 113,984,549 C296S probably damaging Het
Fcgbp A G 7: 28,103,212 T1522A probably benign Het
Foxl2 A C 9: 98,955,932 K91T probably damaging Het
Gm35339 A G 15: 76,356,576 Y488C probably damaging Het
Hdac11 G T 6: 91,166,265 R131L probably damaging Het
Ipo11 T C 13: 106,857,258 I723V probably benign Het
Klhl33 A G 14: 50,896,735 L150P probably damaging Het
Klk1b11 A G 7: 43,997,837 H65R probably damaging Het
Larp7 T C 3: 127,537,036 probably null Het
Ldlrad3 T C 2: 102,113,547 D60G possibly damaging Het
Mlip A T 9: 77,190,381 H177Q probably damaging Het
Mrnip A G 11: 50,199,903 D298G probably benign Het
Npas2 A C 1: 39,336,049 S483R probably benign Het
Nrg3 C A 14: 39,012,000 E310* probably null Het
Olfr1382 T A 11: 49,535,605 L140H probably damaging Het
Olfr504 G T 7: 108,565,413 D127E probably damaging Het
Omg T A 11: 79,502,268 T255S possibly damaging Het
Plekhg6 T C 6: 125,363,663 D578G probably damaging Het
Pygo1 A G 9: 72,942,985 K39E probably damaging Het
Rell2 A G 18: 37,956,941 D66G probably damaging Het
Samd9l A T 6: 3,375,446 I605K probably damaging Het
Sema6d T C 2: 124,664,050 S593P probably damaging Het
Sf3b3 A G 8: 110,825,578 V545A probably benign Het
Speer4f1 T A 5: 17,479,390 probably null Het
Spem1 T C 11: 69,821,148 E230G possibly damaging Het
Sphkap A G 1: 83,280,510 F171L probably damaging Het
Tbc1d13 T C 2: 30,135,510 probably benign Het
Tmem222 A T 4: 133,266,843 N206K probably benign Het
Trnau1ap C T 4: 132,321,770 V41M probably damaging Het
Ttn C T 2: 76,939,043 probably null Het
Ubr3 T C 2: 69,936,024 probably null Het
Uox T G 3: 146,612,509 V55G possibly damaging Het
Vmn2r24 A T 6: 123,779,001 I11F possibly damaging Het
Wasf2 T C 4: 133,194,909 probably null Het
Zbtb4 T C 11: 69,778,628 S726P possibly damaging Het
Zfp534 C T 4: 147,674,469 C581Y probably damaging Het
Zfp551 A T 7: 12,417,181 C100* probably null Het
Other mutations in Cpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02655:Cpt2 APN 4 107907427 missense probably damaging 1.00
IGL02755:Cpt2 APN 4 107907775 missense probably damaging 1.00
IGL02803:Cpt2 APN 4 107907386 missense probably benign
IGL03066:Cpt2 APN 4 107907986 missense probably benign 0.01
IGL03180:Cpt2 APN 4 107906960 missense probably damaging 1.00
R0037:Cpt2 UTSW 4 107907974 missense probably damaging 0.99
R0046:Cpt2 UTSW 4 107904362 splice site probably null
R0046:Cpt2 UTSW 4 107904362 splice site probably null
R0598:Cpt2 UTSW 4 107906938 missense probably damaging 1.00
R1844:Cpt2 UTSW 4 107904255 missense possibly damaging 0.68
R2432:Cpt2 UTSW 4 107904526 nonsense probably null
R6326:Cpt2 UTSW 4 107914316 missense probably benign 0.00
R6682:Cpt2 UTSW 4 107904430 missense probably damaging 1.00
R7463:Cpt2 UTSW 4 107908157 missense probably damaging 1.00
R7491:Cpt2 UTSW 4 107907142 missense probably damaging 1.00
R7572:Cpt2 UTSW 4 107907548 missense probably damaging 1.00
R7645:Cpt2 UTSW 4 107906974 missense possibly damaging 0.92
R8513:Cpt2 UTSW 4 107906926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTCCTGCATCGTTTTC -3'
(R):5'- TCTGGGATATACTTTTGAGGACCC -3'

Sequencing Primer
(F):5'- CTGCATCGTTTTCAGACAGAATCG -3'
(R):5'- ATATACTTTTGAGGACCCGGAGTC -3'
Posted On2018-09-12