Incidental Mutation 'R6803:Col8a2'
ID 533426
Institutional Source Beutler Lab
Gene Symbol Col8a2
Ensembl Gene ENSMUSG00000056174
Gene Name collagen, type VIII, alpha 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock # R6803 (G1)
Quality Score 204.009
Status Validated
Chromosome 4
Chromosomal Location 126286793-126314330 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126312000 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 601 (Y601C)
Ref Sequence ENSEMBL: ENSMUSP00000070270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070132] [ENSMUST00000102617] [ENSMUST00000128435]
AlphaFold P25318
Predicted Effect probably damaging
Transcript: ENSMUST00000070132
AA Change: Y601C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070270
Gene: ENSMUSG00000056174
AA Change: Y601C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 25 33 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
low complexity region 72 105 N/A INTRINSIC
Pfam:Collagen 116 168 1.2e-9 PFAM
low complexity region 207 237 N/A INTRINSIC
internal_repeat_1 240 259 1.3e-7 PROSPERO
low complexity region 260 327 N/A INTRINSIC
low complexity region 342 387 N/A INTRINSIC
internal_repeat_1 388 407 1.3e-7 PROSPERO
low complexity region 408 429 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 471 530 N/A INTRINSIC
low complexity region 545 557 N/A INTRINSIC
C1Q 564 699 2.44e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102617
SMART Domains Protein: ENSMUSP00000099677
Gene: ENSMUSG00000042558

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:ADP_ribosyl_GH 31 344 1.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128435
SMART Domains Protein: ENSMUSP00000123003
Gene: ENSMUSG00000056174

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 25 33 N/A INTRINSIC
Meta Mutation Damage Score 0.6200 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 94.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 2 chain of type VIII collagen. This protein is a major component of the basement membrane of the corneal endothelium and forms homo- or heterotrimers with alpha 1 (VIII) type collagens. Defects in this gene are associated with Fuchs endothelial corneal dystrophy and posterior polymorphous corneal dystrophy type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a thinner Descemet's membrane of the cornea. Mice heterozygous or homozygous for an ENU-induced mutation exhibit thin cornea, corneal epithelium, stroma, and Descemet membrane, and enlarged anterior chamber. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg9 A C 9: 50,789,560 D210A probably benign Het
As3mt T G 19: 46,709,581 M120R probably benign Het
Baz1a T A 12: 54,941,555 S270C probably null Het
Car5a A C 8: 121,923,765 probably null Het
Ccdc187 T A 2: 26,289,779 T223S probably benign Het
Cel T C 2: 28,558,048 N322S probably benign Het
Chd6 T C 2: 160,960,359 E2185G possibly damaging Het
Clcnkb T C 4: 141,405,328 T597A probably benign Het
Cntnap1 A G 11: 101,177,234 Y24C possibly damaging Het
Cog3 A G 14: 75,704,039 S817P probably benign Het
Cpm G T 10: 117,676,097 probably null Het
Cpt2 T C 4: 107,912,664 N79S probably damaging Het
Dnah17 T C 11: 118,125,372 T314A probably benign Het
Dnm1 C A 2: 32,312,754 V46F probably damaging Het
Fat3 C T 9: 15,996,787 V2640M probably damaging Het
Fbxl2 A T 9: 113,984,549 C296S probably damaging Het
Fcgbp A G 7: 28,103,212 T1522A probably benign Het
Foxl2 A C 9: 98,955,932 K91T probably damaging Het
Gm35339 A G 15: 76,356,576 Y488C probably damaging Het
Hdac11 G T 6: 91,166,265 R131L probably damaging Het
Ipo11 T C 13: 106,857,258 I723V probably benign Het
Klhl33 A G 14: 50,896,735 L150P probably damaging Het
Klk1b11 A G 7: 43,997,837 H65R probably damaging Het
Larp7 T C 3: 127,537,036 probably null Het
Ldlrad3 T C 2: 102,113,547 D60G possibly damaging Het
Mlip A T 9: 77,190,381 H177Q probably damaging Het
Mrnip A G 11: 50,199,903 D298G probably benign Het
Npas2 A C 1: 39,336,049 S483R probably benign Het
Nrg3 C A 14: 39,012,000 E310* probably null Het
Olfr1382 T A 11: 49,535,605 L140H probably damaging Het
Olfr504 G T 7: 108,565,413 D127E probably damaging Het
Omg T A 11: 79,502,268 T255S possibly damaging Het
Plekhg6 T C 6: 125,363,663 D578G probably damaging Het
Pygo1 A G 9: 72,942,985 K39E probably damaging Het
Rell2 A G 18: 37,956,941 D66G probably damaging Het
Samd9l A T 6: 3,375,446 I605K probably damaging Het
Sema6d T C 2: 124,664,050 S593P probably damaging Het
Sf3b3 A G 8: 110,825,578 V545A probably benign Het
Speer4f1 T A 5: 17,479,390 probably null Het
Spem1 T C 11: 69,821,148 E230G possibly damaging Het
Sphkap A G 1: 83,280,510 F171L probably damaging Het
Tbc1d13 T C 2: 30,135,510 probably benign Het
Tmem222 A T 4: 133,266,843 N206K probably benign Het
Trnau1ap C T 4: 132,321,770 V41M probably damaging Het
Ttn C T 2: 76,939,043 probably null Het
Ubr3 T C 2: 69,936,024 probably null Het
Uox T G 3: 146,612,509 V55G possibly damaging Het
Vmn2r24 A T 6: 123,779,001 I11F possibly damaging Het
Wasf2 T C 4: 133,194,909 probably null Het
Zbtb4 T C 11: 69,778,628 S726P possibly damaging Het
Zfp534 C T 4: 147,674,469 C581Y probably damaging Het
Zfp551 A T 7: 12,417,181 C100* probably null Het
Other mutations in Col8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Col8a2 APN 4 126309791 missense probably damaging 0.99
IGL01776:Col8a2 APN 4 126309805 unclassified probably benign
IGL03367:Col8a2 APN 4 126312198 missense probably damaging 1.00
R1861:Col8a2 UTSW 4 126311624 unclassified probably benign
R1909:Col8a2 UTSW 4 126312133 missense possibly damaging 0.63
R2038:Col8a2 UTSW 4 126311315 unclassified probably benign
R2866:Col8a2 UTSW 4 126311199 unclassified probably benign
R4013:Col8a2 UTSW 4 126311115 unclassified probably benign
R4586:Col8a2 UTSW 4 126311019 unclassified probably benign
R4995:Col8a2 UTSW 4 126310788 missense probably damaging 0.98
R5160:Col8a2 UTSW 4 126310412 missense possibly damaging 0.77
R5574:Col8a2 UTSW 4 126311268 unclassified probably benign
R5858:Col8a2 UTSW 4 126311300 unclassified probably benign
R8876:Col8a2 UTSW 4 126310854 missense probably damaging 0.96
Z1177:Col8a2 UTSW 4 126311543 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTGCATCTGCCCAATGGTG -3'
(R):5'- AGACCATTGGCCTGATCTGAGG -3'

Sequencing Primer
(F):5'- TGCCCAATGGTGGCGTG -3'
(R):5'- TGATCTGAGGGCATCTGCAC -3'
Posted On 2018-09-12