Incidental Mutation 'R6803:Plekhg6'
ID533436
Institutional Source Beutler Lab
Gene Symbol Plekhg6
Ensembl Gene ENSMUSG00000038167
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 6
SynonymsLOC213522
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6803 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location125362660-125380793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125363663 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 578 (D578G)
Ref Sequence ENSEMBL: ENSMUSP00000037004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032491] [ENSMUST00000042647] [ENSMUST00000144524]
Predicted Effect probably benign
Transcript: ENSMUST00000032491
SMART Domains Protein: ENSMUSP00000032491
Gene: ENSMUSG00000030341

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 44 81 2.4e-7 SMART
TNFR 84 125 2.19e-10 SMART
TNFR 127 166 5.43e-6 SMART
TNFR 168 195 3.41e1 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 263 276 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
DEATH 345 441 8.04e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000042647
AA Change: D578G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037004
Gene: ENSMUSG00000038167
AA Change: D578G

DomainStartEndE-ValueType
RhoGEF 165 352 1.5e-44 SMART
PH 410 511 8.99e-7 SMART
low complexity region 535 557 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125880
SMART Domains Protein: ENSMUSP00000121968
Gene: ENSMUSG00000030341

DomainStartEndE-ValueType
TNFR 2 42 2.09e-7 SMART
TNFR 44 83 5.43e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144524
SMART Domains Protein: ENSMUSP00000117470
Gene: ENSMUSG00000030341

DomainStartEndE-ValueType
TNFR 5 44 5.43e-6 SMART
TNFR 46 73 3.41e1 SMART
transmembrane domain 90 112 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 168 179 N/A INTRINSIC
Blast:DEATH 223 295 1e-13 BLAST
SCOP:d1icha_ 269 295 3e-8 SMART
Meta Mutation Damage Score 0.2304 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 94.7%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg9 A C 9: 50,789,560 D210A probably benign Het
As3mt T G 19: 46,709,581 M120R probably benign Het
Baz1a T A 12: 54,941,555 S270C probably null Het
Car5a A C 8: 121,923,765 probably null Het
Ccdc187 T A 2: 26,289,779 T223S probably benign Het
Cel T C 2: 28,558,048 N322S probably benign Het
Chd6 T C 2: 160,960,359 E2185G possibly damaging Het
Clcnkb T C 4: 141,405,328 T597A probably benign Het
Cntnap1 A G 11: 101,177,234 Y24C possibly damaging Het
Cog3 A G 14: 75,704,039 S817P probably benign Het
Col8a2 A G 4: 126,312,000 Y601C probably damaging Het
Cpm G T 10: 117,676,097 probably null Het
Cpt2 T C 4: 107,912,664 N79S probably damaging Het
Dnah17 T C 11: 118,125,372 T314A probably benign Het
Dnm1 C A 2: 32,312,754 V46F probably damaging Het
Fat3 C T 9: 15,996,787 V2640M probably damaging Het
Fbxl2 A T 9: 113,984,549 C296S probably damaging Het
Fcgbp A G 7: 28,103,212 T1522A probably benign Het
Foxl2 A C 9: 98,955,932 K91T probably damaging Het
Gm35339 A G 15: 76,356,576 Y488C probably damaging Het
Hdac11 G T 6: 91,166,265 R131L probably damaging Het
Ipo11 T C 13: 106,857,258 I723V probably benign Het
Klhl33 A G 14: 50,896,735 L150P probably damaging Het
Klk1b11 A G 7: 43,997,837 H65R probably damaging Het
Larp7 T C 3: 127,537,036 probably null Het
Ldlrad3 T C 2: 102,113,547 D60G possibly damaging Het
Mlip A T 9: 77,190,381 H177Q probably damaging Het
Mrnip A G 11: 50,199,903 D298G probably benign Het
Npas2 A C 1: 39,336,049 S483R probably benign Het
Nrg3 C A 14: 39,012,000 E310* probably null Het
Olfr1382 T A 11: 49,535,605 L140H probably damaging Het
Olfr504 G T 7: 108,565,413 D127E probably damaging Het
Omg T A 11: 79,502,268 T255S possibly damaging Het
Pygo1 A G 9: 72,942,985 K39E probably damaging Het
Rell2 A G 18: 37,956,941 D66G probably damaging Het
Samd9l A T 6: 3,375,446 I605K probably damaging Het
Sema6d T C 2: 124,664,050 S593P probably damaging Het
Sf3b3 A G 8: 110,825,578 V545A probably benign Het
Speer4f1 T A 5: 17,479,390 probably null Het
Spem1 T C 11: 69,821,148 E230G possibly damaging Het
Sphkap A G 1: 83,280,510 F171L probably damaging Het
Tbc1d13 T C 2: 30,135,510 probably benign Het
Tmem222 A T 4: 133,266,843 N206K probably benign Het
Trnau1ap C T 4: 132,321,770 V41M probably damaging Het
Ttn C T 2: 76,939,043 probably null Het
Ubr3 T C 2: 69,936,024 probably null Het
Uox T G 3: 146,612,509 V55G possibly damaging Het
Vmn2r24 A T 6: 123,779,001 I11F possibly damaging Het
Wasf2 T C 4: 133,194,909 probably null Het
Zbtb4 T C 11: 69,778,628 S726P possibly damaging Het
Zfp534 C T 4: 147,674,469 C581Y probably damaging Het
Zfp551 A T 7: 12,417,181 C100* probably null Het
Other mutations in Plekhg6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Plekhg6 APN 6 125372551 missense probably null 0.89
IGL01466:Plekhg6 APN 6 125372624 splice site probably benign
IGL01621:Plekhg6 APN 6 125372099 missense probably damaging 1.00
IGL01679:Plekhg6 APN 6 125374979 missense probably benign 0.45
IGL01696:Plekhg6 APN 6 125378830 missense probably benign 0.00
IGL02600:Plekhg6 APN 6 125370600 nonsense probably null
IGL02604:Plekhg6 APN 6 125377379 splice site probably benign
IGL02668:Plekhg6 APN 6 125372803 splice site probably benign
R0370:Plekhg6 UTSW 6 125370660 missense probably damaging 1.00
R0426:Plekhg6 UTSW 6 125364629 unclassified probably null
R1182:Plekhg6 UTSW 6 125372492 missense probably damaging 0.99
R1401:Plekhg6 UTSW 6 125363109 missense probably damaging 1.00
R1855:Plekhg6 UTSW 6 125375839 missense probably damaging 1.00
R1888:Plekhg6 UTSW 6 125363343 missense probably damaging 1.00
R1888:Plekhg6 UTSW 6 125363343 missense probably damaging 1.00
R2264:Plekhg6 UTSW 6 125377468 missense probably benign 0.00
R2991:Plekhg6 UTSW 6 125370469 missense probably damaging 0.99
R3980:Plekhg6 UTSW 6 125373183 missense probably damaging 1.00
R4193:Plekhg6 UTSW 6 125373118 missense probably benign 0.01
R4227:Plekhg6 UTSW 6 125378805 missense probably damaging 0.99
R4689:Plekhg6 UTSW 6 125373181 missense probably benign 0.43
R5532:Plekhg6 UTSW 6 125372551 missense possibly damaging 0.80
R5573:Plekhg6 UTSW 6 125375792 missense possibly damaging 0.56
R6885:Plekhg6 UTSW 6 125378730 missense probably benign
R7105:Plekhg6 UTSW 6 125378805 missense probably damaging 0.99
R7599:Plekhg6 UTSW 6 125374660 missense probably damaging 0.99
R7626:Plekhg6 UTSW 6 125363668 missense probably benign 0.08
R8069:Plekhg6 UTSW 6 125363046 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGGATCCCTTCTGGCAACTC -3'
(R):5'- CTGAGACAGGGCAGTAAGTTTG -3'

Sequencing Primer
(F):5'- TTCTGGCAACTCTGGGGC -3'
(R):5'- CAGTAAGTTTGGAGGAGACATTTC -3'
Posted On2018-09-12